IN VITRO DIAGNOSTIC METHODS

专利摘要:
method for quantifying cell-free nucleic acids, method for calculating a fragmentation index, method for determining the integrity index, method for qualitative and quantitative detection of the presence of a genetic polymorphism, method for analyzing cell-free nucleic acids, methods for identifying body fluid, method for identifying or analyzing body fluid and diagnostic methods the present invention relates to an in vitro method of detecting cell-free nucleic acids, preferably cell-free dna (cfdna) in a sample of body fluid from an individual or patient, wherein the method comprises the step of determining in a precise and sensitive manner the concentration of cell-free nucleic acid in the sample and / or the determination of the concentration or amount of said cell-free nucleic acid cell of a certain size range and / or the integrity index or proportion of the size fraction (sfr) of said nucleic acid cell-free eico and / or the determination of the presence of genetic polymorphisms (such as a single nucleotide polymorphism (snps) or mutations). the invention also encompasses a method for discriminating body fluids from individuals where cfdnas are highly released by comparing the size profile obtained by at least one of the three cfdna size ranges. the invention also encompasses a method for analyzing cell-free nucleic acids in individuals for the diagnosis, prognosis or assessment of the evolution of a physiological state, such as the progression of a tumor or metastatic cancer, or to monitor the effectiveness of a treatment against cancer in a patient or for teragnostic purposes by performing the analysis of these biomarkers.
公开号:BR112013005046B1
申请号:R112013005046-2
申请日:2011-09-05
公开日:2020-09-08
发明作者:Alain Thierry；Franck Molina
申请人:Centre National De La Recherche Scientifique (C.N.R.S.)；
IPC主号:

专利说明:

[0001] [001] The present invention is directed to an in vitro method of detecting cell-free nucleic acids, preferably cell-free DNA (cfDNA) in a body fluid sample from an individual or patient, in which the method comprises the step of determining precisely and sensitive the concentration of cell-free nucleic acid in the sample and / or determining the concentration or quantity of said cell-free nucleic acid of a given size range and / or index of integrity or proportion of size fraction (SFR) of said cell-free nucleic acid and / or determining the presence of genetic polymorphisms (such as a single nucleotide polymorphism (SNPs) or mutations). The invention also encompasses a method for discriminating individual body fluids where cfDNAs are highly released by comparing the size profile obtained by at least one of the three cfDNA size ranges. The invention also encompasses a method for analyzing cell-free nucleic acids in individuals for the diagnosis, prognosis or evaluation of the evolution of a physiological state, such as the progression of a tumor or metastatic cancer, or to monitor the effectiveness of a treatment against cancer in a patient or for teragnostic purposes by performing the analysis of these biomarkers.
[0002] [002] In the coming years, the detection of cell free nucleic acid (cf - cell free), such as circulating DNA (cirDNA or “ctDNA”), can become an innovative non-invasive technology that allows the diagnosis of a condition specific pathological or physiological, the prognosis and monitoring of cancer, the choice of therapeutic guidance for each patient, and mass screening as a complement to existing tests. Cell-free nucleic acids have been proposed as biomarkers for several diseases (cancer, diabetes, sickle cell disease, autoimmune diseases, myocardial infarction, multiple sclerosis, ...), as well as for specific physiological conditions, such as (physical exercise intense, hemodialysis, pregnancy), or some clinical conditions (trauma, sunburn, sepsis, ...).
[0003] [003] There are two ways previously described in the literature for using cell-free nucleic acids as biomarkers: the first is by measuring its concentration and the second, studying its nucleotide sequence.
[0004] [004] Extracellular nucleic acids, or cell-free (DNA or RNA), have been detected in many biological fluids, such as blood, urine, feces, milk, bronchial lavage and ascites. It is believed that the cfDNA found in other body fluids may be originated mainly from circulating nucleic acids. Most of the study on cell-free nucleic acids was carried out by detecting and quantifying circulating DNA (DNA in the blood).
[0005] [005] Circulating DNA (blood DNA, cirDNA) was initially found in plasma samples by Mandel and Metals (1) and a while later, it was characterized in plasma samples from cancer patients by Stroun et al (2). The technical progress that allowed the detection - and specific quantification of RNAs or DNAs has made the diagnosis and follow-up of diseases possible. CirDNAs carry the genetic changes related to the development of some diseases (including cancer) and, therefore, for more than ten years they have been considered as potential non-invasive diagnostic markers of different physiological states (prenatal testing, etc.) .) or pathological (cancer, etc ...).
[0006] [006] The detection of genetic changes in cirDNA appears to be a particularly attractive diagnostic approach (3-5) but which is currently limited to costly and time-consuming invasive approaches, such as DNA sequencing from tumor cuts. Since mutant genes are not only cancer markers, but are also, at least partially, causes tumor growth, they have advantages over conventional non-invasive markers, such as fecal blood or serum PSA. Particularly, conventional markers are not involved in a pathogenic way in the process of tumorigenesis and are less specific for neoplasia than mutations. Genetic analysis of cirDNA in blood samples will be easy to put into practice and can potentially detect different types of cancers early and very sensitive. Colorectal cancer remains a serious public health problem that has yet to be resolved. Only an early screening of patients at risk (age, heredity, lifestyle and chronic inflammatory diseases of the colon are the main risk factors mentioned) remains one of the safest ways to prevent this disease (6, 7). For this reason, in France, as in most industrialized countries, the search for the best mass screening strategy for colorectal cancer is a public health priority. Only one test is currently used for the mass screening of colorectal cancer in individuals over 50: the Hemoccult II® test. However, Hemoccult II® appears to be of low sensitivity and exhibits an important rate of false positives and false negatives. A second-line test is a colonoscopy, which shows very high sensitivity and specificity and a low, but significant, rate of false negatives. However, this test is invasive and can lead to serious complications (bleeding 1/300, perforation 1/800).
[0007] [007] It is known that the levels of cell-free DNA in the plasma of patients with colorectal cancer (CRC) are significantly higher due to a healthy patient, and these levels progressively decrease in the follow-up period in tumor-free patients, and increase in patients with recurrence or metastasis (22). Thus, the CRC patient represents a useful model of physiological or pathological conditions that result in or lead to a large release of cell-free DNA.
[0008] [008] The mechanisms of cfDNA release are poorly understood, but it has been suggested that necrosis, apoptosis, phagocytosis or active release may be involved. Tumor development is associated with necrosis of certain parts of the tumor, as well as adjacent, non-tumoral tissues. On the other hand, the body's defense mechanisms lead to the destruction of cancer cells, by phagocytosis or apoptosis. With regard to cirDNA, it was established that necrosis and phagocytosis lead to DNA degradation to smaller sizes rarely less than 1000 base pairs (bp) (5, 7, 9). In the case of apoptosis, the region between the nucleosomes can be degraded and this leads to the release of DNA into the circulation with a size of 180-200 bp (the size of a nucleosome plus the ligand) or multiple of these (7).
[0009] [009] Many studies have been started in order to identify abnormal forms of DNA in plasma or serum (4, 7). At the moment, there are contradictory results, although very high cancer detection rates have been reported. These studies, although promising, raised many questions about the confidence (or: the reliability) of using abnormal cirDNA as a cancer biomarker (4, 7). In particular, it is imperative to develop technologies that can detect the number (quantity) of mutant DNA and the specific detection of mutation (s) in the same sample. In the case of colorectal cancer, many mutations have been identified and it is currently possible to define the sequence of appearance of such mutations, in fact, it appears that the APC gene, then KRAS (and BRAF), then p53 are, among others, the targets of mutations that lead to the transformation of the normal epithelium to adenoma, and then to dysplasia and finally to metastatic carcinoma (8-11). It is undeniable to think that this approach will be an efficient diagnostic method in the future. However, at the moment, tests for the detection of gene mutation (s) are not specific enough for diagnostic, teragnotic or prognostic use. Currently, there is no specific test or analysis developed for the detection of cell-free nucleic acid, such as cirDNA. The Quantitative Polymerase Chain Reaction (Q-PCR) technology is the method of choice for the detection and quantification of genetic variations or mutations. SNPs (single nucleotide polymorphisms) are among the most frequent mutations, they can allow discrimination of subjects (patients) and can be responsible for tumor progression in many cancers. They correspond to the alteration of a single nucleotide, thus making it difficult to discriminate between the sequence that carries the point mutation and the non-mutated sequence. Consequently, its detection, and mainly its quantification, by Q-PCR are of low specificity and sensitivity.
[0010] [010] Current cancer therapies are focused on the patient's disease rather than on individual patients. However, inter-individual differences in the disposition of drugs or pharmacokinetics have led to heterogeneity in the patient's response to traditional cancer chemotherapy. Thus, there remains a need for teragnostic methods capable of making cancer therapies more accurate, effective and safer for individual patients. In addition, the detection of mutations or a specific genetic marker (eg, polymorphisms) can help to assess the individual response of various therapies, such as antibody therapy, cytostatic therapy or antibody-dependent cell-mediated cytotoxicity.
[0011] [011] The precise cirDNA size profile was found in only two publications:
[0012] [012] -The D. Lo team is one of the two best leadership teams in this field and that analyzed the size distribution of maternal and fetal DNA in maternal plasma by using Q-PCR and developing a set of primers for the amplification of the sequence from 105 to 798 bp (16). They suggested that "most of the cirDNA molecules were in the range of 145 to 201 bp" (which is approximately the size of the nucleosome). Because of this, these authors have not studied or discussed the possibility of the existence of cirDNA with size less than 105 bp.
[0013] [013] -The size profile of CirDNA was studied very recently (January 2010) using a high performance method: single-molecule microfluidic spectroscopy (20). Although the shape and size profile of cirDNA extracted from the serum of patients with lung cancer in stages I and IV is somewhat similar to our results, they concluded that "the greatest power of distinction occurred within a limit of 800 bp." For this reason, the authors never mentioned or discussed ctDNAs of sizes less than 320, arguing that "below 320 bp the two curves look similar".
[0014] [014] Prior to this invention, there was insufficient evidence that amplicon of size <100 bp is better compared to what was conventionally established. Since it was previously demonstrated that the shorter-length cirDNA molecules should theoretically be> 180 bp (size of a nucleosome) and since PCR efficiency is conventionally (using genomic DNA) optimal when amplification is performed of a sequence in the size range of 150-300 bp, all reports previously described demonstrated the use of amplicon detection of about 150 bp in size when analyzing cfDNA. Q-PCR has often been used in the study of cell-free nucleic acids in the literature. The set of primers designed was primarily defined on their efficiency in amplifying a target nucleic acid region, and sometimes coincided with the fact that some reports suggested a high proportion of mononucleosoma in cell-free nucleic acids (amplification of the region nucleic acids in the size range of 100-180 bp compared to the 150-300 bp conventionally used, such as by genomic DNA analysis). Among the vast literature, only a couple of reports described the use of the detection of amplified fragments <100 bp, but they were based only on the technical aspects linked to the design of specific primers and / or region of the target gene, but never with the assumption that the increased proportion of cirDNA with size <100 bp was present in a specific physiological condition or pathology.
[0015] [015] For example, Ellinger et al (BJU International, 2009, V.104, 5, 48-52) used a PCR primer system that amplified a 79 bp and 230 bp region of the mitochondrial ctDNA for the purpose of determining an integrity index by comparing the quantification using the PCR system for the amplification of the DNA region of a smaller and larger size than the size of a mononucleosome (180-200 bp). They indicate that the 79 bp primer pair amplified a 79 bp fragment that corresponds to the total mtDNA and includes DNA truncated by apoptosis.
[0016] [016] Similarly, the same group (Ellinger et al, 2009, V.181, 1, 363-371) quantified an ATBC amplicon of 106, a 193 and a 384 bp from ctDNA extracts and obtained levels of Similar DNA using the ACTB-106 and -193 primer set.
[0017] [017] Board et al (Annals of the New York academy of Sciences, 2008, 98-107) quantified by amplicon of 272 and 512 bp by Q-PCR from extracts of ctDNA for the same purpose of Ellinger et al. Koide et al (Prenatal Diagnosis, 2005, V.25, 604-607) quantified an amplicon of 63, a 107, a 137, a 193, a 313, a 392 and a 524 bp of the circulating fetal DNA SYR gene free of cell in maternal plasma to study degradation from storage and freezing, further examining the fragmentation of said ctDNA.
[0018] [018] DNA is a chain of nucleotides and the modification or alteration of one or more nucleotides (genetic polymorphisms) in the sequence of a gene can alter the message of the gene and lead to a modified or inactive protein. Genetic mutations are the cause or risk factor for several pathologies and the detection of these mutations seems to be increasingly an efficient way to diagnose, monitor and better guide the therapeutic choice for a patient. Quantitative Polymerase Chain Reaction (Q-PCR) technology is the method of choice for the detection and quantification of genetic mutations. Point mutations (single nucleotide polymorphisms - single nucleotide polymorphisms (SNPs)) correspond to the alteration of a single nucleotide in one of the two alleles and, more rarely, in both alleles. This, among other reasons (inherent in the non-specificity of the Q-PCR technology), leads to a low specificity of the Q-PCR to discriminate the sequences with point mutations from the non-mutant sequences that are called "wild type" (WT). On the other hand, the detection of somatic point mutations (which do not interest reproductive cells, gametes, and therefore are not inherited) must be very sensitive particularly in the case of circulating DNA since it was established that only 0.1-10% of the circulating DNA of an individual with cancer carries the mutation (7). It is for this reason that many modifications of Q-PCR technology have been described, such as ARMS-PCR, TaqMAMA and FLAG-PCR. These technologies require the use of bases modified enzymes or additional procedures in addition to reagents.
[0019] [019] Currently, there is no specific test or analysis developed for the detection of cell-free nucleic acids, and particularly for the detection of mutations such as mutations associated with cancer pathology, or with resistance to cancer treatment.
[0020] [020] In particular, there is a need to provide a method for detecting genetic mutations, such as mutations in the KRAS gene, using a blood sample. In fact, colorectal cancer is a major cause of cancer and a common cause of cancer death in Europe. In this cancer, the target therapy has appeared in recent years with antibodies to the epidermal growth factor receptor (EGFR), but several studies have shown that the benefit of these antibodies is limited only to patients with the wild-type KRAS gene. These findings represent an important step in the field of personalized medicine by the teragnosis method that can determine the ideal treatment for each patient, in order to avoid over-treatment with drugs that have potentially toxic adverse effects, but with few benefits.
[0021] [021] The detection of cell-free nucleic acids has been a frequent topic in the literature for over 10 years. However, partly due to the clinical origin of the analyzed samples, the origin and form of cell-free nucleic acids have been poorly studied systematically.
[0022] [022] The authors demonstrated that the size of the nucleic fragment is of crucial importance in the analysis of cell-free nucleic acid and in particular when its concentration is determined. They revealed that specific detection of mutations by measuring the cfDNA concentration is possible in one step by comparing the determined concentration aiming at a short mutated fragment (<100 bp) and a non-mutated fragment of similar size, when both fragments are <100 bp and similar sizes (+/- 10%).
[0023] [023] This method of identifying the presence or absence of a genetic mutation is very convenient since it is very fast and not very expensive. In addition, it allows dispensing with sophisticated techniques such as sequencing. On the other hand, sequencing leads to an answer without possible doubts (but due to contamination or maintenance errors).
[0024] [024] The cell-free DNA in a cancer patient consists of tumor DNA and DNA that is not of tumor origin. Very little is known about the respective contribution of these two types of cell-free DNA during tumor progression. IntPlex should allow you to move forward on this issue and that information will bring valuable diagnostic and / or prognostic benefits. In fact, the amount of mutated DNA, and therefore tumor DNA, can be linked by this method directly to the amount of non-tumor DNA. The calculation of this percentage can be correlated both with the total amount of cirDNA released and with the progression or regression of the tumor.
[0025] [025] The integrity index of cirDNA has been associated with the concentration of mononucleosomes (180-200 bp), that is, to estimate the rate of apoptosis. Very few studies have described how to calculate the integrity index, and this is usually done in a not very strict way. This has led to contradictory results on the study of its changes during tumor progression (13-19). In addition, the term integrity appears to be inappropriate when one takes into account the fact that very little or no genomic DNA circulates in the blood. If the data from the aforementioned studies are contradictory and confusing about the clinical use of the integrity index, it is because they did not take into account the possibility that a large proportion of cirDNA is <100 bp.
[0026] [026] The present inventors, for the first time, demonstrated the presence of a higher proportion of cirDNA with a size <100 bp which is directly correlated with the increase in the concentration of cirDNA, particularly in samples from cancer patients. The inventors measured the integrity index by measuring the concentration of cfDNA with the detection of two amplified fragments: a short of <100 bp and a long one ranging from 250-400 bp. They demonstrated that this allowed for more specific and sensitive discrimination between cirDNAs from healthy individuals and from cancer patients. Then, the identification of some pathologies (such as cancer) or specific physiological state (such as intense effort) can be achieved by the means discovered in the present invention. This has never been observed or predicted before.
[0027] [027] By focusing particularly on the study of the size of cell-free nucleic acids, with the aim of optimizing their measurement and, especially, the specificity and sensitivity of detection by Q-PCR, the inventors have developed, through new exemplary ways or methods, first the quantification of cell-free nucleic acids in the body fluid sample, and second, the analysis of genetic polymorphisms, such as the mutation of the KRAS and BRAF genes, in cell-free nucleic acids. Third, the inventors have developed an integrated test that combines the estimate of the fragmentation rate of cell-free nucleic acids (also called "integrity index" or "rate of apoptosis" in the present description) as a third biomarker. Such detection / quantification of cell-free nucleic acids can be an innovative technology for the coming years as a non-invasive test that allows the diagnosis, teragnosis, prognosis and monitoring of a disease, and mass screening as a complement to tests currently available .
[0028] [028] The Examples below strongly support the interest in measuring such cell-free nucleic acids by methods of the present invention as an innovative tool in various preclinical and clinical investigations.
[0029] [029] The inventors propose in the present invention to use the quantitative PCR technique in a "single step" analytical procedure that is specific for the analysis of cell-free nucleic acids and leads to a simple, robust and highly sensitive and selective method of detection / quantification, which is compatible with a standardized procedure and can be exploited industrially It was previously known that cell free nucleic acids are highly fragmented to sizes below 180 bp, which generally correspond to the length of the sequences amplified by the primers that normally are chosen when PCR is optimally used (between 100 and 300 bp). Thus, unlike the analysis of genomic DNA in which the concentration of quantified DNA is directly proportional to the number of amplified copies (of the genome), the amount of circulating DNA determined by Q-PCR is not proportional to the number of copies. Our method takes into account the specified the size and shape of the circulating DNA. This allows the exact and direct comparison of the concentration of two different sequences and also the calculation of the percentage of one sequence in relation to the other. By determining the size profile of cell-free nucleic acids present in the body fluid sample, the inventors demonstrated that it is possible to discriminate healthy individuals from individuals who have high levels of cfDNA.
[0030] [030] Surprisingly, the inventors demonstrated by using a single-step Q-PCR method, that it is possible to simultaneously determine three important biomarkers for cancer tracking and treatment: (1) the specific amount of cell-free nucleic acids, (2) the presence of a genetic polymorphism (for example, a SNP or a mutation), and (3) the rate of apoptosis (also called the "integrity index" or "fragmentation rate").
[0031] - A diminuição significativa do tempo necessário para a análise, particularmente em comparação com a análise de uma biópsia de tumor (sem necessidade de intervenção do serviço anatomopatológico, ...). - Facilita a coleta de amostras e a manipulação da amostra biológica. - Permite a análise não invasiva de tumores não acessíveis. - Adiciona dois parâmetros clínicos não negligenciáveis, ou seja, a quantidade de ácidos nucleicos livres de célula e a taxa de apoptose (índice de fragmentação ou índice de integridade), cujo valor parece estar diretamente relacionado com o crescimento do tumor. [031] The method of the present invention exhibits in particular the following advantages: - The significant decrease in the time required for the analysis, particularly in comparison with the analysis of a tumor biopsy (without the need for intervention by the anatomopathological service, ...). - Facilitates the collection of samples and the handling of the biological sample. - Allows non-invasive analysis of non-accessible tumors. - Adds two not negligible clinical parameters, that is, the amount of cell-free nucleic acids and the rate of apoptosis (fragmentation index or integrity index), the value of which seems to be directly related to the growth of the tumor.
[0032] - Análise de genes parentais, - Análise de gene com importância clínica (patologias como o câncer, ...), - Teragnóstico, uma estratégia de tratamento que permite orientar a terapia em função de um marcador diagnóstico (ou seja, o estado mutacional de um ou diversos genes); - Análise de origens étnicas, -Determinação do sexo pelo cirDNA fetal, -Evolução de um determinado estado fisiológico. [032] The scope of the present invention relates to all uses of the detection of cell-free nucleic acids, such as, but not limited to: - Analysis of parental genes, - Gene analysis with clinical importance (pathologies such as cancer, ...), - Teragnosis, a treatment strategy that allows therapy to be guided by a diagnostic marker (that is, the mutational state of one or several genes); - Analysis of ethnic origins, -Determination of sex by fetal cirDNA, -Evolution of a certain physiological state.
[0033] [033] As discussed above, there are numerous discrepancies about the ctDNA size pattern in the literature, as mentioned earlier in Ellinger et al. The few recent reports that study ctDNA and describe that ctDNA is found mainly in reduced size, always indicate that the smallest size is approximately the size of mononucleosomes. This is based on several and numerous electrophoresis gel analyzes that clearly show an intense band around 180 bp and a lower one close to 360 bp and sometimes a larger stain, while below 180 bp absolutely no band pops up.
[0034] [034] Our data on the ctDNA size standard as presented in the description of the invention clearly disagrees with this conclusion. Being confident with our conclusion, we demonstrated in Example 8 that a significant amount of DNA below 180 bp is present in the gel.
[0035] -determinar a quantidade ou concentração de ctDNA de tamanho inferior a 100 pb como um parâmetro essencial de análise de ctDNA; - comparar quantidade de ctDNA a partir da fração compreendendo ctDNA de tamanho inferior a 100 pb, com a fração de tamanho entre 150 a 400 pb, ou fração de tamanho maior do que 300 ou 400 pb. [035] Consequently, and as shown by the following examples, mainly ctDNA can be less than 180 bp in size, and in particular less than 100 bp. In accordance with the present invention, the inventors propose: - determine the amount or concentration of ctDNA less than 100 bp in size as an essential parameter for analysis of ctDNA; - compare the amount of ctDNA from the fraction comprising ctDNA of size less than 100 bp, with the size fraction between 150 to 400 bp, or fraction of size greater than 300 or 400 bp.
[0036] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação da concentração ou quantidade do dito ácido nucleico livre de célula na dita amostra de fluido corporal, em que dito ácido nucleico está em uma faixa de tamanho de ácido nucleico com um comprimento inferior a 100 pb. [036] Thus, in a first aspect, the present invention is directed to a method of quantifying cell-free nucleic acids in a body fluid sample, comprising: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) determining the concentration or amount of said cell-free nucleic acid in said body fluid sample, wherein said nucleic acid is in a nucleic acid size range less than 100 bp in length.
[0037] [037] The expression "about" currently means ± 10% of the defined value.
[0038] [038] In an example of a preferred embodiment, the method of the present invention is performed to determine the concentration / amount of cell-free nucleic acid of size less than 100 bp.
[0039] [039] In a preferred embodiment, step c) is carried out by applying the PCR method, and in which the amount / concentration of cell-free nucleic acid size <100 bp is determined by using a set of primers which amplifies a DNA region <100 bp, and preferably <80 bp.
[0040] [040] In a preferred embodiment example, in step c) the amount / concentration of cell-free nucleic acid size fractions <100 bp is determined by calculating the difference from those determined by using two sets of primer pairs for the detection of amplicons of different sizes, one of the two or both <100 bp.
[0041] [041] In another aspect, the present invention is directed to a method for calculating a cell-free nucleic acid fragmentation index by comparing the concentration / amount of size fractions obtained by a method for quantifying free nucleic acids. cell in a body fluid according to the invention.
[0042] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação do perfil de tamanho específico do dito ácido nucleico livre de célula na dita amostra de fluido corporal pela: -determinação, pelo menos, da concentração ou quantidade de ácidos nucleicos curtos com um comprimento inferior a 100 pb,preferencialmente compreendido entre 40 e 99 pb, e-determinação, pelo menos, da concentração ou quantidade de ácidos nucleicos longos com um comprimento superior a 100 pb,preferencialmente compreendido entre 145 pb e 450 pb;ou uma fração (razão) de cfDNA de uma faixa de tamanho específico.[042] In an example of a preferred embodiment, the present invention is directed to a method for determining the specific size profile of cell-free nucleic acids in a body fluid sample, comprising: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) determining the specific size profile of said cell-free nucleic acid in said body fluid sample by: -determination of at least the concentration or amount of short nucleic acids less than 100 bp in length, preferably between 40 and 99 bp, and -determination of at least the concentration or quantity of long nucleic acids over 100 bp in length, preferably between 145 bp and 450 bp; or a fraction (ratio) of cfDNA from a specific size range.
[0043] [043] By "determining a fraction (ratio) of cfDNA in a specific size range", we mean the determination of the ratio between the concentration or amount of free cell nucleic acids having, for example, a length less than 100 bp, preferably between 40 and 99 bp, and the concentration or amount of cell-free nucleic acids having a length greater than 100 bp, preferably between 145 bp and 450 bp, or the inverse ratio.
[0044] [044] More preferably, said cell-free nucleic acid to be quantified by the method of the present invention is an autosome cell-free nucleic acid (or autosome derivative).
[0045] [045] By autosome cell-free nucleic acid, it is intended to refer to cell-free nucleic acid that is not derived from or derived from sex chromosomes.
[0046] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação da concentração ou quantidade do dito ácido nucleico livre de célula na dita amostra de fluido corporal pela: -determinação da concentração ou quantidade de ácidos nucleicos curtos com um comprimento inferior a 100 pb, preferencialmente compreendido entre 40 e 99 pb, e/ou, preferencialmente, e-determinação da concentração ou quantidade de um ácido nucleico longo possuindo um comprimento compreendido entre 145 pb e 450 pb.[046] In an example of a preferred embodiment, the present invention is directed to a method of quantifying cell-free nucleic acids in a body fluid sample, comprising: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) determining the concentration or amount of said cell-free nucleic acid in said body fluid sample by: -determination of the concentration or amount of short nucleic acids less than 100 bp in length, preferably between 40 and 99 bp, and / or, preferably, and - determination of the concentration or amount of a long nucleic acid having a length between 145 bp and 450 bp.
[0047] [047] The inventors have demonstrated that the cell free nucleic acid size profile ("cf NA") is specific when cf NA, particularly circulating DNA ("ct DNA") is released at a higher level than the normal level, being in a higher proportion in the lengths less than 100 bp and, in a much lower proportion in the length ranges of 250-400 bp, and these characteristics are part of the present invention.
[0048] [048] In an example of a preferred embodiment, said cell-free nucleic acid is selected from the group consisting of cell-free DNA, (cfDNA), cell-free RNA, and cell-free siRNA or cell-free miRNA.
[0049] [049] In the present invention, the expression "apoptosis rate", "DNA fragmentation index" and "integrity index" have the same meaning, the level of DNA fragmentation being inverse to the level of integrity index.
[0050] [050] In an example of a preferred embodiment of the method of the present invention, said cell-free nucleic acids are circulating nucleic acids.
[0051] [051] When the present invention is directed to a method of quantifying cell-free nucleic acids in a body fluid sample according to the present invention, said method comprises two steps: c) i) determining the concentration or amount of short nucleic acid that is less than 100 bp in length, preferably between 40 and 99 bp; and c) ii), the determination of the concentration or amount of long nucleic acid having a length between 145 bp and 450 bp; and it is preferable that said long cell free nucleic acid comprises partially or totally said short cell free nucleic acid.
[0052] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação do índice de integridade do ácido nucleico livre de célula na dita amostra de fluido corporal, em que dito índice de integridade é calculado como a razão da concentração ou quantidade de ácido nucleico livre de célula com uma faixa de tamanho "longo” e da concentração ou quantidade de ácido nucleico livre de célula com uma faixa de tamanho "curto”, sendo as ditas concentrações determinadas pelo método de quantificação de ácido nucleico livre de célula em uma amostra de fluido corporal de acordo com a presente invenção, em que dito ácido nucleico com faixa de tamanho curto tem um comprimento inferior a 100 pb, e em que dito ácido nucleico com faixa de tamanho do longo está compreendido entre 180 pb e 450 pb.[052] In another aspect, the invention encompasses a method for determining the integrity index or cell-free nucleic acid in a sample of DNA Integrity Index (DII) / Fraction Size Ratio (SFR) body fluid, in which said method comprises: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) determining the integrity index of cell-free nucleic acid in said body fluid sample, wherein said integrity index is calculated as the ratio of the concentration or amount of cell-free nucleic acid with a "long" size range and the concentration or amount of cell-free nucleic acid with a "short" size range, said concentrations being determined by the cell-free nucleic acid quantification method in a body fluid sample according to the present invention, wherein said nucleic acid with a short size range is less than 100 bp in length, and wherein said nucleic acid with a long size range is between 180 bp and 450 bp.
[0053] [053] In accordance with the present invention, the inventors wish to provide a new calculation of the DNA integrity index that for the first time takes into account the amount of ctDNA less than 100 bp in size. The inventors also want to provide, for the first time, the calculation of the DNA Size Fraction Ratio (SFR), which also includes in its calculation the ratio between the amount of ctDNA that has a specific size range, for example, between 200 and 450 and the amount of ctDNA in size between 60 bp and 100 bp or 43 and 100 bp. The integrity index (corresponding to the amount of cell-free nucleic acid greater than a long length by the amount of cell-free nucleic acid greater than a shorter length) and SFR (corresponding to the ratio of the two fractions of size) are , both, nucleic acid fragmentation rates.
[0054] [054] Thus, the calculation of the integrity index can be done by determining the ratio of the amount of ctDNA of size greater or less than a specific size, or size comprised in a specific range, by the amount of ctDNA of size greater or less than that another specific size, or size included in another specific range; or by the amount of total ctDNA. For example, by determining the ratio between the amount of ctDNA greater than 180-200 bp and the amount of ctDNA less than 100 bp.
[0055] [055] By determining the ratio of determined quantities using the detection of a 300 bp and 60 bp amplicon, one can explain this notion that the value obtained corresponds to% of the amount of ctDNA greater than 300 bp from the amount of ctDNA greater than 60 bp.
[0056] [056] In the present invention, "DNA integrity index" (DII) is intended to refer to the new calculation of the DNA integrity index that takes into account the amount of ctDNA with size less than 100 bp.
[0057] [057] In examples 11 to 15 below, the inventors determined this new calculation of the DNA integrity index or DNA Size Fraction Ratio (SFR) by calculating the ratio of the amount of ctDNA over 200 and the amount of ctDNA with size between 60 bp and 100 bp or 43 and 100 bp. This new calculation that determines the amount of ctDNA with the smallest possible size less than 100 bp allows to make more accurate estimates of the level of fragmentation of the ctDNA, which is more accurate, especially for distinguishing cancer patients and healthy individuals using plasma.
[0058] [058] This new calculation of the DNA integrity index or DNA fraction size ratio (SFR) can be performed in the present invention by a method that does not use the polymerase chain reaction (PCR), such as electrophoresis of capillary zone, capillary zone electrophoresis or chip-based mass spectroscopy; or by an execution method that uses the polymerase chain reaction (PCR) such as the quantitative real-time polymerase chain reaction (Q-PCR).
[0059] [059] When PCR, such as Q-PCR, is implemented, the detection of an amplicon having X bp corresponds, in fact, to quantify all ctDNA fragments having a size greater than or equal to X bp.
[0060] [060] Likewise, when PCR, such as Q-PCR, is implemented, the detection of an amplicon having X bp actually corresponds to the quantification of all ctDNA fragments having a size greater than or equal to X bp.
[0061] [061] When Q-PCR is implemented, the detection of an amplicon with a size less than 100 bp corresponds, in fact, to quantify the ctDNA fragments that are larger than or equal to this size. Consequently, these amplification products (amplicons) having a size of less than 100 bp should be considered when quantifying the total ctDNA.
[0062] [062] For example, when Q-PCR is implemented, the detection of an amplicon having a size equal to 60 bp corresponds, in fact, to quantify the ctDNA fragments having a size greater than or equal to 60 bp, corresponding to the concentration / quantification maximum ctDNA.
[0063] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação da Proporção da Fração de Tamanho (SFR) do ácido nucleico livre de célula, em que dita SFR é calculada como a razão da quantidade de ctDNA possuindo um tamanho específico ou a faixa de tamanho específica e quantidade de ctDNA possuindo outra faixa de tamanho específica ou tamanhos específicos.[063] In another aspect, the present invention is directed to a method for determining said DNA Size Fraction Proportion (SFR), of the cell-free nucleic acid in a body fluid sample, comprising said method: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) the determination of the Size Fraction Proportion (SFR) of the cell-free nucleic acid, wherein said SFR is calculated as the ratio of the amount of ctDNA having a specific size or the specific size range and amount of ctDNA having another specific size range or specific sizes.
[0064] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação do DII ou da Proporção da Fração de Tamanho (SFR) do ácido nucleico livre de célula, em que dito DII ou a SFR é calculado como a razão entre a quantidade de ctDNA com tamanho superior a 200 pb e a quantidade de ctDNA que está entre 60 pb e 100 pb ou entre 43 pb e 100 pb, ou entre 60-145 pb.[064] In another aspect, the present invention is directed to a method for determining the recalculation of the mentioned DNA integrity index (DII) or the Fraction Size (SFR) Ratio of the cell-free nucleic acid in a sample of body fluid, comprising this method: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) the determination of the DII or the Fraction Size Proportion (SFR) of the cell-free nucleic acid, where said DII or SFR is calculated as the ratio between the amount of ctDNA larger than 200 bp and the amount of ctDNA that is between 60 bp and 100 bp or between 43 bp and 100 bp, or between 60-145 bp .
[0065] [065] In an example of a preferred embodiment of the method for determining the integrity index of cell-free nucleic acid or SFR in a sample of body fluid of the present invention, said cell-free nucleic acid with long size range comprises total , or partially, said cell-free nucleic acid with a short size band.
[0066] [066] In an example of a preferred embodiment of the method for determining the integrity index or SFR of the present invention, said long size range is between 250 bp and 350 bp, and said short size range is between 50 bp and 99 bp.
[0067] [067] In a preferred embodiment of the method of the present invention, the cell free nucleic acid concentration or the cell free nucleic acid integrity or SFR index is determined by a method that does not employ the polymerase chain reaction (PCR), such as capillary zone electrophoresis, chip-based capillary zone electrophoresis or mass spectroscopy.
[0068] [068] Such methods are well known to those skilled in the art (see, for example, “Comparisons between capillary zone electrophoresis and real-time PCR for quantification of circulating DNA levels in human sera”, Fuming Sang et al., Journal of Chromatography B Volume 838, issue 2, of July 11, 2006, pages 122-128; “Prenatal diagnosis of -thalassemia by chip-based capillary electrophoresis”, Hua Hu et al, Prenatal Diagnosis, Volume 28 issue 3, pages 222-229 , 2008).
[0069] [069] In an example of a more preferred embodiment of the method of the present invention, the concentration of cell-free nucleic acid or the integrity index or SFR of cell-free nucleic acid is determined by a method that employs the chain reaction of polymerase (PCR).
[0070] [070] In this most preferred embodiment example, the PCR method is chosen from the group consisting of the quantitative real-time polymerase chain reaction (Q-PCR).
[0071] [071] PCR or Q-PCR methods are standard methods well known to those skilled in the art.
[0072] [072] Among the specific methods of PCR or Q-PCR, the methods of "allele-specific PCR”, "allele-specific Q-PCR” or "allele-specific Q-PCR using blocking oligonucleotides” can be particularly mentioned .
[0073] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) - a determinação da concentração do fragmento curto amplificado a partir do ácido nucleico livre de célula na dita amostra de fluido corporal, em que dito fragmento curto de ácido nucleico tem um comprimento inferior a 100 pb, preferencialmente compreendido entre 40 e 99 pb, e/ou -a determinação da concentração ou quantidade do fragmento longo amplificado a partir do ácido nucleico livre de célula na dita amostra de fluido corporal, em que dito fragmento longo de ácido nucleico tem um comprimento superior ou igual a 100 pb, preferencialmente compreendido entre 145 e 450 pb, e/ou[073] Thus, when the concentration of cell-free nucleic acid is determined by a method that employs the polymerase chain reaction (PCR), the present invention is also directed to a method of quantifying cell-free nucleic acids in a body fluid sample, comprising: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) - determining the concentration of the amplified short fragment from the cell-free nucleic acid in said body fluid sample, wherein said short nucleic acid fragment is less than 100 bp in length, preferably between 40 and 99 bp, and / or -determining the concentration or quantity of the amplified long fragment from the cell-free nucleic acid in said body fluid sample, wherein said long nucleic acid fragment has a length greater than or equal to 100 bp, preferably between 145 and 450 bp, and / or
[0074] [074] In an example of a preferred embodiment, said step c) is a step of: c) determining the amount of cell-free nucleic acid in said body fluid sample, subtracting the value resulting from the amplification of a fragment> 100 bp of a fragment that is <100 bp, preferably subtracting the value resulting from the amplification of a fragment with a size range between 100-145 bp by the value resulting from the amplification of a fragment with a size range between 60-99 bp.
[0075] [075] More preferably, said short fragment amplified from the cell-free nucleic acid has a length of between 55 and 65 bp, about 60 bp (more preferably 60 bp ± 6 bp).
[0076] [076] When the present invention is directed to a method of quantifying cell-free nucleic acids in a body fluid sample according to the present invention using a polymerase chain reaction (PCR) method, said method comprises two steps: c) i) determining the concentration or quantity of the amplified short fragment; and c) ii), that of determining the concentration or quantity of the amplified long fragment, and it is preferred that said amplified long fragment comprises partially or totally the short fragment.
[0077] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) a determinação do índice de integridade ou a SFR do ácido nucleico livre de célula na dita amostra de fluido corporal, em que dito índice de integridade ou a SFR é calculado como a razão entre a concentração do fragmento longo amplificado e o fragmento curto amplificado a partir do dito ácido nucleico livre de célula, em que dito fragmento curto tem um comprimento inferior a 100 pb, e em que dito fragmento longo amplificado compreende entre 180 pb e 450 pb. [077] In an identical aspect, when the integrity index or SFR of the cell free nucleic acid is determined by a method that employs the polymerase chain reaction (PCR), the present invention is also directed to a method for determining the integrity index of cell-free nucleic acid in a sample of body fluid, comprising this method: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) determining the integrity index or SFR of the cell-free nucleic acid in said body fluid sample, wherein said integrity index or SFR is calculated as the ratio between the concentration of the amplified long fragment and the amplified short fragment from said cell free nucleic acid, wherein said short fragment is less than 100 bp in length, and wherein said amplified long fragment comprises between 180 bp and 450 bp.
[0078] [078] In an example of a preferred embodiment of the method for determining the integrity index or SFR of the present invention employing the polymerase chain reaction (PCR), said amplified long fragment is between 250 bp and 350 bp, and said short amplified fragment is between 50 bp and 99 bp.
[0079] [079] In an example of a preferred embodiment of the method according to the present invention for determining the integrity index or SFR of cell-free nucleic acid in a body fluid sample, said amplified long fragment comprises partially or totally the short fragment .
[0080] [080] In an example of a more preferred embodiment of the method for determining the integrity index or SFR of the invention, said amplified long fragment comprises totally or partially said short fragment.
[0081] a) a identificação de um sujeito de interesse; b) a obtenção de um fluido corporal do dito sujeito; c) determinação da concentração do fragmento curto amplificado a partir do ácido nucleico livre de célula na dita amostra de fluido corporal, em que dito fragmento curto de ácido nucleico livre de célula que é amplificado contém dito polimorfismo genético a ser detectado, e em que dito fragmento curto de ácido amplificado tem um comprimento inferior de 100 pb, preferencialmente um comprimento compreendido entre 40 e 99 pb. Mais preferivelmente, dito fragmento curto amplificado contendo dito polimorfismo genético a ser detectado tem um comprimento compreendido entre 55 e 65 pb, e mais preferivelmente cerca de 60 pb. [081] In another aspect, the present invention encompasses a method for the detection of a genetic polymorphism, such as a mutation or SNP, in which said method comprises the steps of: a) the identification of a subject of interest; b) obtaining a body fluid from said subject; c) determining the concentration of the amplified short fragment from the cell-free nucleic acid in said body fluid sample, wherein said short cell-free nucleic acid fragment that is amplified contains said genetic polymorphism to be detected, and in which said short fragment of amplified acid is less than 100 bp in length, preferably between 40 and 99 bp in length. More preferably, said short amplified fragment containing said genetic polymorphism to be detected is between 55 and 65 bp in length, and more preferably about 60 bp.
[0082] -A1A2 por um lado e B1B2 por outro; são representações de duas sequências curtas; -dado que o comprimento da sequência A1A2 e B1B2 varia entre 50 a 100 pb, e que elas são diferentes no comprimento em +/- 20%; - quer A1A2 ou B1B2 compreendendo o polimorfismo genético; - e considerando CB1B2 e CA1A2, respectivamente, a concentração inicial mensurada de ácido nucleico extraído correspondente à detecção do fragmento curto B1B2, e do fragmento curto A1A2, respectivamente, i) calculando a % CB1B2/CA1A2, onde B1B2 é definido como a sequência contendo o polimorfismo genético; ouii) calculando a % CA1A2/CB1B2; onde A1A2 é definido como a sequência contendo o polimorfismo genético, e opcionalmente, a determinação de que a % CB1B2/CA1A2 ou % CA1A2/CB1B2 é maior do que um limiar específico é significativa da detecção qualitativa da presença de um polimorfismo genético.[082] In an example of a preferred embodiment, the present invention is directed to a method for the qualitative detection of the presence of a genetic polymorphism in a cell-free nucleic acid, said method comprising the steps of: a) determining the concentration or quantity cell-free nucleic acids in a body fluid sample; b) determine the qualitative detection of the presence of a genetic polymorphism, integrating the following parameters and steps: -A1A2 on the one hand and B1B2 on the other; they are representations of two short strings; -since the length of the sequence A1A2 and B1B2 varies between 50 to 100 bp, and that they are different in length by +/- 20%; - either A1A2 or B1B2 comprising the genetic polymorphism; - and considering CB1B2 and CA1A2, respectively, the initial measured extracted nucleic acid concentration corresponding to the detection of the short fragment B1B2, and the short fragment A1A2, respectively, i) calculating the% CB1B2 / CA1A2, where B1B2 is defined as the sequence containing the genetic polymorphism; or ii) calculating the% CA1A2 / CB1B2; where A1A2 is defined as the sequence containing the genetic polymorphism, and optionally, the determination that the% CB1B2 / CA1A2 or% CA1A2 / CB1B2 is greater than a specific threshold is significant from the qualitative detection of the presence of a genetic polymorphism.
[0083] [083] Preferably, in step ii), the% of them is the quantitative detection of mutated cell free nucleic acid fragments.
[0084] a)determinação da concentração ou quantidade de ácidos nucleicos livres de célula em uma amostra de fluido corporal por um método de quantificação de ácidos nucleicos livres de célula de acordo com a presente invenção e em que a concentração ou a quantidade de ácidos nucleicos livres de célula é determinada por um método que emprega a PCR; b)determinação da detecção quantitativa da presença do polimorfismo genético, pela integração dos seguintes parâmetros e das seguintes etapas: -A1A2 em uma mão e B1B2 na outra mão são representações de duas sequências curtas amplificadas;-dado que o comprimento da sequência A1A2 e B1B2 varia entre 50 a 100 pb, e que elas são diferentes no comprimento em +/- 20%;- quer A1A2 ou B1B2 compreendendo o polimorfismo genético;-e considerando CB1B2 e CA1A2, respectivamente, a concentração inicial mensurada de ácido nucleico extraído correspondente à detecção do fragmento curto amplificado B1B2, e do fragmento curto amplificado A1A2, respectivamente,i) calculando a % CB1B2/CA1A2, onde B1B2 é definido como a sequência amplicon contendo o polimorfismo genético; ouii) calculando a % CA1A2/CB1B2, onde A1A2 é definido como a sequência amplicon contendo o polimorfismo genético,opcionalmente, a determinação que % CB1B2/CA1A2 ou % CA1A2/CB1B2 é maior do que um limiar específico é significativa da detecção qualitativa da presença de um polimorfismo genético.[084] In an example of a preferred embodiment, the present invention is directed to a method for the qualitative detection of the presence of a genetic polymorphism in a cell-free nucleic acid, the said method comprising the steps of: a) determination of the concentration or amount of cell-free nucleic acids in a body fluid sample by a method of quantifying cell-free nucleic acids according to the present invention and wherein the concentration or amount of cell-free nucleic acids it is determined by a method that employs PCR; b) determination of the quantitative detection of the presence of genetic polymorphism, by integrating the following parameters and the following steps: -A1A2 in one hand and B1B2 in the other hand are representations of two short amplified strings; -since the length of the sequence A1A2 and B1B2 varies between 50 to 100 bp, and that they are different in length by +/- 20%; - either A1A2 or B1B2 comprising the genetic polymorphism; -and considering CB1B2 and CA1A2, respectively, the measured initial extracted nucleic acid concentration corresponding to the detection of the amplified short fragment B1B2, and of the amplified short fragment A1A2, respectively, i) calculating the% CB1B2 / CA1A2, where B1B2 is defined as the amplicon sequence containing the genetic polymorphism; or ii) calculating the% CA1A2 / CB1B2, where A1A2 is defined as the amplicon sequence containing the genetic polymorphism, optionally, the determination that% CB1B2 / CA1A2 or% CA1A2 / CB1B2 is greater than a specific threshold is significant from the qualitative detection of the presence of a genetic polymorphism.
[0085] [085] Preferably, in step ii),% of them is the quantitative detection of mutated cell free nucleic acid fragments.
[0086] [086] In a preferred embodiment example, the positivity threshold is determined for each mutation using a convenient number of known samples, more preferably the positivity threshold is at least 2%, 5%, 7%, 8%, 9 %, 10%, 12.5%, 15%.
[0087] [087] Also part of the present invention is a method for the qualitative detection of the presence of a genetic polymorphism in a cell-free nucleic acid according to the invention; and where the nucleic acid corresponding to the genetic polymorphism of interest on the coding strand is located at the 3 'end of the primer starting at position B1 or A2, and where the method employing the PCR is an allele-specific PCR.
[0088] [088] In an example of a preferred embodiment, said genetic polymorphism to be detected is an inherited genetic polymorphism or a somatic genetic polymorphism.
[0089] -polimorfismos genéticos capazes de discriminar um indivíduo ou população étnica, -polimorfismos genéticos na região não codificante que impactam uma função biológica, -polimorfismos genéticos devido a modificação pós-transcricional, tal como a edição de RNA; ou -polimorfismos genéticos na região codificante, tal como uma mutação que implica a modificação da sequência de proteína. [089] By genetic polymorphisms, it is intended to designate particularly, but not limited to: -genetic polymorphisms capable of discriminating against an individual or ethnic population, -genetic polymorphisms in the non-coding region that impact a biological function, - genetic polymorphisms due to post-transcriptional modification, such as RNA editing; or -genetic polymorphisms in the coding region, such as a mutation involving modification of the protein sequence.
[0090] [090] Among these genetic polymorphisms, the preferred genetic polymorphisms are of a nucleic acid selected from the group consisting of the genetic polymorphism associated with a pathology or a physiological state, or specific genetic polymorphisms in nucleic acid, particularly exonic, intronic or in the regions non-coding the nucleic acid sequence.
[0091] -Aplicação do método para a detecção de um polimorfismo genético de acordo com a presente invenção, no dito ácido nucleico livre de célula, e -Aplicação do método de acordo com a presente invenção para a determinação do índice de integridade do dito ácido nucleico livre de célula. [091] Also covered by the present invention is a method that preferably employs PCR, in particular Q-PCR, for the detection of genetic polymorphism in said cell-free nucleic acid in a sample of body fluid; for the determination of the integrity index or SFR of the cell-free nucleic acid, in which said method comprising the steps of: -Application of the method for the detection of a genetic polymorphism according to the present invention, in said cell-free nucleic acid, and -Application of the method according to the present invention for determining the integrity index of said cell-free nucleic acid.
[0092] -dito fragmento longo amplificado compreende um fragmento curto não mutado e o fragmento curto mutado contendo dito polimorfismo genético (por exemplo, um SNP ou uma mutação) a ser detectado; e - dito fragmento longo amplificado compreende entre 250 pb e 350 pb e dito fragmento curto amplificado é inferior a 100 pb e preferencialmente compreende entre 50 pb e 99 pb. [092] In an example of a preferred embodiment, said method comprises the step of implementing the method of the invention to determine the integrity index or SFR of the cell-free nucleic acid in a sample of body fluid, wherein in said method: - said amplified long fragment comprises a short mutated fragment and the short mutated fragment containing said genetic polymorphism (for example, a SNP or a mutation) to be detected; and - said amplified long fragment comprises between 250 bp and 350 bp and said amplified short fragment is less than 100 bp and preferably comprises between 50 bp and 99 bp.
[0093] [093] More preferably, said amplified fragment mutated and non-mutated is between 55 and 65 bp in length, with about 60 bp being more preferred.
[0094] [094] More specifically, in the method for determining the Integrity Index or SFR of cell-free nucleic acid in a body fluid sample, said amplified long fragment comprises partially or totally two short fragments, in which one of the short amplified fragments contains a genetic polymorphism.
[0095] [095] By the term "partially comprising a fragment" it is intended in the present invention that the long fragment contains at least 10 consecutive bp, more preferably 15, 20, 25, 30, 35 or 40 consecutive bp of the referenced short fragment.
[0096] [096] In an also preferred embodiment of the method of the present invention, the concentration of said cell free nucleic acid fragment of said cell free nucleic acid is calculated for a mutated cell free nucleic acid fragment and / or a fragment of non-mutated cell-free nucleic acid.
[0097] [097] By mutated fragment and non-mutated fragment, it is intended in the present invention a fragment that exhibits and does not exhibit, respectively, the genetic polymorphism that is desired to be detected by the method of the present invention.
[0098] [098] In an example of a preferred embodiment of the said method of the present invention above, the ratio between the concentration of long fragments and short fragments is calculated for the mutated and / or short mutated fragments.
[0099] [099] In an example of a particular embodiment, the method of the present invention further comprises a step of determining the concentration of cell-free nucleic acid fragments that have a specific genetic polymorphism, said fragments exhibiting the genetic polymorphism with a defined length and in that said concentration is compared with the concentration of non-mutated fragments, and said non-mutated fragments are approximately the same length as the mutated fragments, preferably the length of the amplified mutated or non-mutated fragments can be similar by + or - 20%.
[0100] -uma etapa de determinação da concentração do fragmento não mutado e fragmento mutado no extrato de ácido nucleico livre de célula, e -o cálculo da percentagem da quantidade de fragmentos curtos mutados em razão aos fragmentos curtos não mutados obtidos ou não, sendo o sujeito considerado como possuindo dito polimorfismo genético (por exemplo, um SNP ou mutação) se dita percentagem calculada é maior do que um valor limiar associado ao dito polimorfismo genético. [0100] In an example of a preferred embodiment of the method for detecting a specific genetic polymorphism of the present invention, said method further comprises: -a step for determining the concentration of the non-mutated fragment and mutated fragment in the cell-free nucleic acid extract, and -the calculation of the percentage of the amount of short fragments mutated due to the short mutated fragments obtained or not, the subject being considered to have said genetic polymorphism (for example, a SNP or mutation) if said calculated percentage is greater than a value threshold associated with said genetic polymorphism.
[0101] [0101] When the method implements PCR, particularly Q-PCR, for the detection of genetic polymorphism in said cell-free nucleic acid in a sample of body fluid, in an example of a still preferred embodiment of the method of the present invention, the the concentration of said amplified fragment of said cell-free nucleic acid is calculated for an amplified mutated fragment and / or an amplified non-mutated fragment.
[0102] [0102] By mutated fragment and non-mutated fragment, it is intended in the present invention a fragment that exhibits and does not exhibit, respectively, the genetic polymorphism that is desired to be detected by the method of the present invention.
[0103] [0103] In an example of a preferred embodiment of the method stated above of the present invention above, the ratio between the concentration of the amplified long fragment and the amplified short fragment is calculated for the amplified mutated short fragment and / or amplified non-mutated short fragment.
[0104] [0104] In an example of a particular embodiment, the method of the present invention further comprises a step of determining the concentration of an amplified fragment of cell-free nucleic acid that has a specific genetic polymorphism, wherein said amplified fragment exhibiting the genetic polymorphism has a defined length; and wherein said concentration is compared with the concentration of unmutated amplified fragment, and said unmuted fragment has approximately the same length as the mutated fragment, preferably the length of the amplified mutated or unmutated fragments can be similar by + or - 20%.
[0105] -uma etapa de determinação da concentração do fragmento amplificado não mutado e fragmento amplificado mutado no extrato de ácido nucleico livre de célula, e -o cálculo da percentagem da quantidade de fragmento curto mutado amplificado em razão ao fragmento curto não mutado amplificado obtido ou não, sendo o sujeito considerado como possuindo dito polimorfismo genético (por exemplo, um SNP ou mutação) se dita percentagem calculada é maior do que um valor limiar associado ao dito polimorfismo genético. [0105] In an also preferred embodiment of the method for detecting a specific genetic polymorphism of the present invention implementing PCR, said method further comprises: -a step for determining the concentration of the mutated amplified fragment and mutated amplified fragment in the cell-free nucleic acid extract, and -the calculation of the percentage of the amount of amplified short mutated fragment due to the obtained non-mutated short fragment obtained or not, the subject being considered to have said genetic polymorphism (for example, a SNP or mutation) if said calculated percentage is greater than a threshold value associated with said genetic polymorphism.
[0106] a) quantificação do dito ácido nucleico livre de célula de acordo com a invenção pela aplicação de um método de reação em cadeia da polimerase quantitativo em tempo real (Q-PCR); e b) determinação do índice de integridade do dito ácido nucleico livre de célula de acordo com a invenção através de um método que emprega a Q-PCR, e c) detecção da presença do polimorfismo genético no dito ácido nucleico livre de célula de acordo com a invenção por um método que emprega a Q-PCR. [0106] In another particularly preferred aspect, the present invention is directed to a method for the analysis of cell-free nucleic acids, particularly circulating DNA, in an individual, the said method comprising the steps of: a) quantification of said cell-free nucleic acid according to the invention by applying a quantitative polymerase chain reaction method in real time (Q-PCR); and b) determining the integrity index of said cell-free nucleic acid according to the invention using a method using Q-PCR, and c) detecting the presence of the genetic polymorphism in said cell-free nucleic acid according to the invention by a method employing Q-PCR.
[0107] [0107] In an example of a preferred embodiment, said nucleic acid is a nucleic acid that carries tumor-associated genetic changes.
[0108] -dos genes da família RAS, preferencialmente KRAS ou NRAS, carregando alterações genéticas associadas a tumores, preferencialmente alterações genéticas associadas a CRC, e - do gene BRAF. [0108] The most preferred nucleic acids are selected from the group consisting of: -the genes of the RAS family, preferably KRAS or NRAS, carrying genetic alterations associated with tumors, preferably genetic alterations associated with CRC, and - the BRAF gene.
[0109] [0109] The term "body fluid sample" intends and preferably designates the body fluids selected from the group consisting of whole blood, serum, plasma, urine, sputum fluids, colonic effluent, bone marrow effluent, lymph, fluid cerebrospinal, tear fluid, sweat, milk, feces, bronchial washes and ascites.
[0110] [0110] In an example of a preferred embodiment, the body fluid sample is a blood sample selected from the group consisting of plasma and serum.
[0111] [0111] In an preferred embodiment of the method of the present invention, said cell-free nucleic acid is selected from the group of endogenous or exogenous cell-free nucleic acids, and particularly the cell-free nucleic acid is selected from the group consisting of cell-free nucleic acids obtained from viruses, bacteria, fungi, fetuses or xenografts.
[0112] [0112] Among the free cell nucleic acids endogenous from a subject of interest, it is preferable that said subject of interest is an individual who suffers from, or is at risk of developing a disease or exhibits a physiological state or condition.
[0113] [0113] In an example of a preferred embodiment, said disease is a cancer, more preferably, but not limited to; a cancer selected from the group of colorectal cancer, lung cancer, breast cancer, prostate cancer, gynecological cancer, head and neck cancer, thyroid cancer, pancreatic cancer, liver cancer or hematopoietic cancer.
[0114] [0114] In an equally preferred embodiment, said cancer is metastatic cancer.
[0115] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluidos corporais por um método da presente invenção, do cfDNA com tamanho na faixa de 50-100 pb e tamanho superior a 101 pb; b) comparação da razão obtida entre o nível destes duas faixas de tamanho de fragmentos para cada uma das duas amostras de fluido corporal, sendo a razão entre a faixa de tamanho longo/curto < 1, e preferencialmente < 0,75 indicativa da presença de um tumor. [0115] In another aspect, the present invention is directed to a method for identifying or analyzing the body fluid (preferably the plasma) of a cancer patient from the body fluid (preferably the plasma) from healthy individuals, wherein said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, of cfDNA with a size in the range of 50-100 bp and a size greater than 101 bp; b) comparison of the ratio obtained between the level of these two fragment size ranges for each of the two body fluid samples, with the ratio between the long / short size range <1, and preferably <0.75 indicating the presence of a tumor.
[0116] a) quantificação do DNA livre de célula (cfDNA) na amostra de fluido corporal por um método da presente invenção, do cfDNA com tamanho na faixa de 50-100 pb e tamanho superior a 101 pb; b) cálculo da razão obtida entre o nível destes duas faixas de tamanho de fragmentos para dita amostra de fluido corporal, sendo a razão entre a faixa de tamanho longo/curto < 1, e preferencialmente < 0,75 indicativa da presença de um tumor. [0116] The present invention is directed to a method for identifying whether a body fluid (preferably plasma) from an individual's sample is from a cancer patient or from healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the body fluid sample by a method of the present invention, of cfDNA with a size in the range of 50-100 bp and a size greater than 101 bp; b) calculation of the ratio obtained between the level of these two fragment size ranges for said body fluid sample, with the ratio between the long / short size range <1, and preferably <0.75 indicating the presence of a tumor.
[0117] a) quantificação do DNA livre de células (cfDNA) em duas amostras de fluido corporal através de um método da presente invenção, sendo o cfDNA de um tamanho que está dentro da faixa de 50-100 pb e um tamanho que está dentro da faixa de 100-145 pb, preferencialmente um tamanho que está dentro da faixa de 73 a 99 pb e dentro da faixa de 100-120 pb; b) comparação da razão obtida entre estas duas faixas de tamanho de fragmentos das duas amostras de fluido corporal, em que a razão entre a faixa de tamanho longo/curto < 1, e preferencialmente < 0,5 é indicativa da presença de um tumor. [0117] In an example of a preferred embodiment, the present invention is directed to a method for identifying or analyzing the body fluid (preferably the plasma or serum) of a cancer patient from the body fluid (preferably the plasma or serum) to from healthy individuals, in which said method comprises the steps of: a) quantification of cell free DNA (cfDNA) in two body fluid samples using a method of the present invention, the cfDNA being of a size that is within the range of 50-100 bp and a size that is within the range of 100-145 bp, preferably a size that is within the range of 73 to 99 bp and within the range of 100-120 bp; b) comparison of the ratio obtained between these two fragment size ranges of the two body fluid samples, in which the ratio between the long / short size range <1, and preferably <0.5, is indicative of the presence of a tumor.
[0118] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluido corporal por um método da presente invenção, sendo o cfDNA de tamanho < 249 pb e tamanho > 249 pb, preferencialmente, cfDNA de tamanho < 100 pb e tamanho que está dentro da faixa de 249-409 pb, e mais preferivelmente um tamanho que está dentro da faixa de 73-100 pb e dentro da faixa de 300-357 pb; b) comparação da razão obtida entre estas duas faixas de tamanho de fragmentos das duas amostras de fluido corporal, em que a razão entre a faixa de tamanho longo/curto < 0,5, e preferencialmente <0,1 é indicativa da presença de um tumor. [0118] In another aspect, the present invention is directed to a method for identifying or analyzing the body fluid (preferably the plasma or serum) of a cancer patient from the body fluid (preferably the plasma or serum) of healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, the cfDNA being size <249 bp and size> 249 bp, preferably cfDNA size <100 bp and size being within the range of 249-409 bp, and more preferably a size that is within the range of 73-100 bp and within the range of 300-357 bp; b) comparison of the ratio obtained between these two fragments size ranges of the two body fluid samples, in which the ratio between the long / short size range <0.5, and preferably <0.1 is indicative of the presence of a tumor.
[0119] a) quantificação do DNA livre de célula nas duas amostras de fluidos corporais por um método da presente invenção, em que os fragmentos cfDNA cuja concentração é determinada para cada amostra de fluido corporal são fragmentos com comprimentos superiores a 180 pb e fragmentos curtos com comprimentos inferiores a 100 pb; b) comparação da razão obtida entre estas duas concentrações de fragmentos para cada uma das duas amostras de fluido corporal, em que a razão entre os tamanhos longo/curto < 0,4, e preferencialmente <0,1 é indicativa da presença de um tumor. [0119] In another aspect, the present invention is directed to a method for identifying or analyzing the body fluid (preferably the plasma or serum) of a cancer patient from the body fluid (preferably the plasma or serum) of healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA in the two body fluid samples by a method of the present invention, in which the cfDNA fragments whose concentration is determined for each body fluid sample are fragments with lengths greater than 180 bp and short fragments with shorter lengths at 100 bp; b) comparison of the ratio obtained between these two concentrations of fragments for each of the two samples of body fluid, in which the ratio between the long / short sizes <0.4, and preferably <0.1, is indicative of the presence of a tumor .
[0120] a) quantificação do DNA livre de célula nas duas amostras de fluidos corporais por um método da presente invenção, em que os fragmentos amplificados cuja concentração é determinada para cada amostra de fluido corporal são fragmentos com comprimentos superiores a 180 pb e fragmentos curtos com comprimentos inferiores a 100 pb; b) comparação da razão obtida entre estas duas concentrações de fragmentos para cada uma das duas amostras de fluido corporal, em que a razão entre os tamanhos longo/curto < 0,4, e preferencialmente <0,1 é indicativa da presença de um tumor. [0120] In another aspect, when PCR, and particularly Q-PCR is implemented, the present invention is directed to a method for identifying or analyzing the body fluid (preferably plasma or serum) of a cancer patient from the body fluid (preferably plasma or serum) from healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA in the two body fluid samples by a method of the present invention, in which the amplified fragments whose concentration is determined for each body fluid sample are fragments with lengths greater than 180 bp and short fragments with shorter lengths at 100 bp; b) comparison of the ratio obtained between these two concentrations of fragments for each of the two samples of body fluid, in which the ratio between the long / short sizes <0.4, and preferably <0.1, is indicative of the presence of a tumor .
[0121] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluido corporal por um método da presente invenção, sendo o cfDNA com tamanho > 145 pb; b) calculando a percentagem da quantidade de cfDNA obtida a partir da quantidade de cfDNA total, em que uma % que é inferior a 20%, e preferencialmente %, é indicativa da presença de um tumor. [0121] In another aspect, the present invention is directed to a method for identifying or analyzing the body fluid (preferably the plasma) of a cancer patient from the body fluid (preferably the plasma) from healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, the cfDNA being> 145 bp in size; b) calculating the percentage of the amount of cfDNA obtained from the amount of total cfDNA, in which a% that is less than 20%, and preferably %, is indicative of the presence of a tumor.
[0122] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluido corporal por um método da presente invenção, estando o cfDNA em uma faixa de tamanho de 60-80 pb, 100-145 pb e 180-400 pb; b) comparação direta dos três níveis de quantificação obtidos entre os indivíduos saudáveis e não saudáveis. [0122] In another aspect, the present invention is directed to a method for identifying or analyzing body fluid (preferably plasma) from individuals where cfDNA is highly released, such as cancer patients, from body fluid ( preferably plasma) from healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, the cfDNA being in a size range of 60-80 bp, 100-145 bp and 180-400 bp; b) direct comparison of the three levels of quantification obtained between healthy and unhealthy individuals.
[0123] [0123] The inventors found that there are three cfDNA size ranges by which the concentration / quantity can be determined, and that it can identify, analyze or discriminate between cfDNA from healthy individuals and cfDNA from individuals where cfDNA is highly released, such as cancer patients. The size range is 60-80 bp, 100-145 bp and 180-400 bp. The diagnosis, prognosis, teragnosis or evolution of a specific physiological state can be assessed by comparing the cfDNA size profile, preferably by combining at least three concentration values obtained when targeting fragments of about 70 bp, about 100 bp and about 300 bp, and preferably, combining them in a logistic (logarithmic) function.
[0124] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluido corporal por um método da presente invenção, estando o cfDNA em uma faixa de tamanho de 60-80 pb, 100-145 pb e 180-400 pb; b) determinação de um perfil de tamanho usando estes três valores como parâmetros em uma função logística. [0124] Thus, in another aspect, the present invention is directed to a method for discriminating body fluid (preferably plasma) from individuals where cfDNA is highly released, such as in cancer patients, from body fluid (preferably plasma) from healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, the cfDNA being in a size range of 60-80 bp, 100-145 bp and 180-400 bp; b) determination of a size profile using these three values as parameters in a logistic function.
[0125] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluido corporal por um método da presente invenção, sendo o cfDNA de diversos tamanhos na faixa de 50 - 400 pb; b) comparação do perfil de tamanho obtido por estas três faixas de tamanho entre as duas amostras de fluidos corporais, preferencialmente pela combinação de pelo menos três valores de concentração obtidos quando se objetiva fragmentos de cerca de 70 pb, cerca de 100 pb e cerca 300 pb, e preferencialmente, combinando-os em uma função logística, tal como uma função logarítmica. [0125] In the same aspect, the present invention is also directed to a method for discriminating body fluid (preferably plasma) from individuals where cfDNA is highly released, such as in cancer patients, from body fluid (preferably plasma) from healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, the cfDNA being of different sizes in the range of 50 - 400 bp; b) comparison of the size profile obtained by these three size ranges between the two samples of body fluids, preferably by combining at least three concentration values obtained when fragments of about 70 bp, about 100 bp and about 300 bp, and preferably, combining them into a logistic function, such as a logarithmic function.
[0126] [0126] In an identical aspect, the present invention is also directed to a method for discriminating a mutated cell-free nucleic acid fragment from an unmutated cell-free nucleic acid fragment in a sample / biological fluid, wherein said method comprises the steps of: determining and comparing the ratio between the concentration of long and short fragments calculated for the mutated fragment and for the non-mutated fragment, and in which in said method: -this ratio is compared in various sizes between the range of 50450 bp, preferably said long fragment is comprised between 200 bp and 450 bp preferably at least two concentration values, such as about 200 bp and about 300 bp, and said short fragments are less than 145 bp and are preferably between 50 bp and 99 bp.
[0127] [0127] Preferably, the ratio 80-145 bp / 145-300 bp, or 100145 bp / 145-350 bp is compared between the mutated and non-mutated cell-free nucleic acid fragment present in the biological fluid.
[0128] a) quantificação do DNA livre de célula (cfDNA) nas duas amostras de fluido corporal por um método da presente invenção, estando o cfDNA em uma faixa de tamanho de 60-80 pb, 100-145 pb e 180-400 pb; b) comparação do perfil de tamanho obtido por estas três faixas de tamanho entre as duas amostras de fluidos corporais, preferencialmente pela combinação de pelo menos três valores de concentração obtidos quando se objetiva fragmentos de cerca de 70 pb, cerca de 100 pb e cerca 300 pb, e preferencialmente, combinando-os em uma função logística, tal como uma função logarítmica. [0128] Also preferred in the present invention is a method for discriminating body fluid (preferably plasma or serum) from individuals where cfDNA is highly released, such as in cancer patients, from body fluid (preferably plasma or serum ) of healthy individuals, in which said method comprises the steps of: a) quantification of cell-free DNA (cfDNA) in the two body fluid samples by a method of the present invention, the cfDNA being in a size range of 60-80 bp, 100-145 bp and 180-400 bp; b) comparison of the size profile obtained by these three size ranges between the two samples of body fluids, preferably by combining at least three concentration values obtained when fragments of about 70 bp, about 100 bp and about 300 bp, and preferably, combining them into a logistic function, such as a logarithmic function.
[0129] [0129] In an example of a preferred embodiment, the method for discriminating body fluid according to the present invention, is implemented for diagnosis, prognosis, teragnosis, or for monitoring the evolution of a specific physiological state in an individual, in which the comparison of the size profiles obtained in step b) is indicative of that specific physiological state.
[0130] a) cálculo repetidamente durante um intervalo de tempo do índice de integridade ou SFR de um ácido nucleico livre de célula em uma amostra de fluido corporal obtida do dito indivíduo, em que a presença do dito ácido nucleico está associada ao dito estado fisiológico específico, por um método para a determinação do índice de integridade ou SFR de um ácido nucleico livre de célula em uma amostra de fluido corporal de acordo com a presente invenção; e b) comparação dos índices de integridade ou SFR obtidos e determinando se dito índice de integridade do ácido nucleico livre de célula variou ao longo deste um intervalo de tempo. [0130] In another aspect, the present invention is directed to a method for the diagnosis, prognosis, teragnosis or for the evaluation of the evolution of a specific physiological state in an individual, preferably in an individual where the cfDNA is highly released, in which said method comprises the steps of: a) calculation repeatedly over a period of time of the integrity index or SFR of a cell-free nucleic acid in a body fluid sample obtained from said individual, in which the presence of said nucleic acid is associated with said specific physiological state, for example a method for determining the integrity index or SFR of a cell-free nucleic acid in a sample of body fluid according to the present invention; and b) comparing the integrity indexes or SFR obtained and determining whether that integrity index of the cell-free nucleic acid varied over this time interval.
[0131] [0131] In an example of a preferred embodiment, said specific physiological state is a physiological state that results from the release of cfDNA or the apoptosis of cells, preferably selected from the group consisting of cancer, diabetes, sickle cell disease, trauma of tissues, sunburn, hemodialysis or intense exertion.
[0132] [0132] In a specific aspect, the above method of the present invention is directed to a method for the prognosis, diagnosis or teragnosis of tumor progression and a patient, in which in step a) said nucleic acid associated with the specific physiological state is associated said tumor; and in that in step b), a decrease in the integrity index over this time interval indicates the progression of the cancer.
[0133] [0133] In an example of a preferred embodiment, a decrease in the integrity index or SFR to less than 0.5, preferably less than 0.1, is indicative of cancer progression.
[0134] a) cálculo, de maneira repetida durante um intervalo de tempo, da concentração de ácido nucleico livre de célula curto mutado ou não mutado em uma amostra de fluido corporal obtida do dito indivíduo, em que a presença do dito ácido nucleico está associada ao dito estado fisiológico específico, por um método de quantificação de ácido nucleico livre de célula em um fluido corporal de acordo com a presente invenção, e b) comparação das concentrações obtidas e determinando se a concentração do dito fragmento mutado ou não mutado amplificado de ácido nucleico livre de célula variou ao longo deste intervalo de tempo. [0134] In another aspect, the present invention is directed to a method for the diagnosis, prognosis, teragnosis or for the evaluation of the evolution of a specific physiological state in an individual, preferably in an individual where the cfDNA is highly released, in which said method comprises the steps of: a) calculating, repeatedly over a period of time, the concentration of mutated or non-mutated short cell free nucleic acid in a sample of body fluid obtained from said individual, in which the presence of said nucleic acid is associated with said state specific physiological, by a method of quantifying cell-free nucleic acid in a body fluid according to the present invention, and b) comparing the concentrations obtained and determining whether the concentration of said amplified mutated or non-mutated fragment of cell-free nucleic acid varied over this time interval.
[0135] [0135] In an example of a preferred embodiment, said specific physiological state is a physiological state that results from the release of cfDNA, preferably selected from the group consisting of autoimmune lupus, septicemia, myocardial infarction, multiple sclerosis or stress production intense.
[0136] [0136] In an also preferred embodiment of the above method, said nucleic acid associated with a specific physiological state is associated with said tumor; and wherein in step b) an increase in the concentration of said mutated or non-mutated amplified fragment of cell-free nucleic acid during this time interval is indicative of the progression of the cancer.
[0137] a) calcular durante um intervalo de tempo o índice de integridade do ácido nucleico livre de célula em uma amostra de fluido corporal obtida a partir do dito paciente para pelo menos um ácido nucleico marcador do câncer utilizando um método de quantificação de ácido nucleico livre de célula de acordo com a presente invenção, e b) comparando o índice de integridade obtido e determinando se dito índice de integridade do dito ácido nucleico livre de célula estava aumentado ou diminuído durante este intervalo de tempo, em que um aumento no dito índice de integridade é indicador da eficácia e uma diminuição no índice de integridade é indicadora de uma falta de eficácia do tratamento do câncer. [0137] In another aspect, the present invention is directed to a method for monitoring the effectiveness of a cancer treatment in a patient, comprising the steps of: a) calculate over a period of time the integrity index of cell free nucleic acid in a sample of body fluid obtained from said patient for at least one cancer marker nucleic acid using a cell free nucleic acid quantification method according to the present invention, and b) comparing the obtained integrity index and determining whether said integrity index of said cell free nucleic acid was increased or decreased during this time interval, in which an increase in said integrity index is an indicator of effectiveness and a decrease in the index of integrity is indicative of a lack of effectiveness of cancer treatment.
[0138] a)a detecção qualitativa da presença de um polimorfismo genético, tal como um SNP ou uma mutação, no dito ácido nucleico livre de célula de acordo com a presente invenção; b) a quantificação do dito ácido nucleico livre de célula de acordo com a presente invenção; e c) a determinação da taxa de apoptose pela implementação da determinação do índice de integridade do dito ácido nucleico livre de célula de acordo com a presente invenção, e dito método integra os seguintes parâmetros e cálculo: -A1A2 por um lado e B1B2 por outro são representações das sequências curtas amplificadas; e A1B2 a sequência longa amplificada.-A1A2 ou B1B2 compreendem o polimorfismo genético; -considerando CB1B2, CA1A2 e CA1B2, respectivamente, a concentração inicial mensurada de ácido nucleico extraído correspondente à detecção do fragmento curto amplificado B1B2, fragmento curto amplificado A1A2 e fragmento longo amplificado A1B2, respectivamente;-a detecção qualitativa da presença de um polimorfismo genético: -% CB1B2/CA1A2 maior do que um limiar específico, onde B1B2 é definido como a sequência amplicon contendo o polimorfismo genético; ou-% CA1A2/CB1B2 maior do que um limiar específico, onde A1A2 é definido como a sequência amplicon contendo o polimorfismo genético;-a avaliação do índice de integridade através da determinação da razão CB1B2/CA1B2 ou CA1A2/CA1B2, em que, considerando que X e Y são as distâncias no ácido nucleico entre as extremidades 5' dos primers, ou o comprimento dos fragmentos amplificados (ou amplicons): (A1A2) = (B1B2) = X L (A1B2) = Y com X < 180 e Y > X, preferencialmente, 50 < X < 100 e 200 < Y < 450.[0138] In another aspect, the present invention is directed to a method for the analysis of cell-free nucleic acids, particularly circulating DNA, in an individual, such as in a patient who exhibits a tumor or who is likely to have a tumor comprising this method the steps of: a) the qualitative detection of the presence of a genetic polymorphism, such as a SNP or a mutation, in said cell-free nucleic acid according to the present invention; b) quantifying said cell-free nucleic acid according to the present invention; and c) determining the rate of apoptosis by implementing the determination of the integrity index of said cell-free nucleic acid according to the present invention, and said method integrates the following parameters and calculation: -A1A2 on the one hand and B1B2 on the other are representations of the amplified short sequences; and A1B2 the amplified long sequence. -A1A2 or B1B2 comprise genetic polymorphism; -considering CB1B2, CA1A2 and CA1B2, respectively, the measured initial extracted nucleic acid concentration corresponding to the detection of the amplified short fragment B1B2, the amplified short fragment A1A2 and the amplified long fragment A1B2, respectively; -qualitative detection of the presence of a genetic polymorphism: -% CB1B2 / CA1A2 greater than a specific threshold, where B1B2 is defined as the amplicon sequence containing the genetic polymorphism; or -% CA1A2 / CB1B2 greater than a specific threshold, where A1A2 is defined as the amplicon sequence containing the genetic polymorphism; -the evaluation of the integrity index by determining the ratio CB1B2 / CA1B2 or CA1A2 / CA1B2, where, considering that X and Y are the distances in the nucleic acid between the 5 'ends of the primers, or the length of the amplified fragments (or amplicons): (A1A2) = (B1B2) = XL (A1B2) = Y with X <180 and Y> X, preferably 50 <X <100 and 200 <Y <450.
[0139] [0139] In an example of a preferred embodiment, said nucleic acid corresponding to the genetic polymorphism of interest on the coding strand is located at the 3 'end of the primer starting at position B1 or A2, and where the method implementing the PCR is a PCR allele-specific.
[0140] [0140] In a preferred embodiment example, said amplified A1B2 long fragment partially or totally comprises the short mutated fragment and the mutated fragment containing said genetic polymorphism (for example, a SNP or mutation) to be detected (A1A2 and B1B2 or B1B2 and A1A2, respectively).
[0141] [0141] In a preferred embodiment example, said A1B2 amplified long fragment is 300 bp +/- 20% in length, and the non-mutated short fragment (A1A2 or B1B2) and the mutated fragment (B1B2 or A1A2) are 60 bp +/- 20% in length.
[0142] a) determinação da concentração de ácido nucleico livre de célula em uma amostra de fluido corporal a partir do dito paciente por um método de quantificação de ácido nucleico livre de célula de acordo com a presente invenção; e b) a detecção de um polimorfismo genético (por exemplo, um SNP ou mutação) no dito fragmento curto amplificado do dito ácido nucleico livre de célula por um método de acordo com a presente invenção. [0142] In another aspect, the present invention is directed to a method for the diagnosis or prognosis of tumor progression in a patient, or a teragnotic method that comprises the determination of tumor progression in a patient, comprising said method the step of: a) determining the concentration of cell-free nucleic acid in a sample of body fluid from said patient by a method of quantifying cell-free nucleic acid according to the present invention; and b) detecting a genetic polymorphism (e.g., a SNP or mutation) in said short amplified fragment of said cell-free nucleic acid by a method according to the present invention.
[0143] a) estudo de pelo menos dois biomarcadores selecionados a partir do grupo de: -determinação da concentração de ácido nucleico livre de célula em uma amostra de fluido corporal a partir do dito paciente por um método de quantificação de ácido nucleico livre de célula de acordo com a presente invenção;-A detecção de um polimorfismo genético no dito ácido nucleico livre de célula por um método de acordo com a presente invenção, em que a classificação do paciente como tendo ou não dito polimorfismo genético é obtida determinando se percentagem de ácido nucleico livre de célula mutado versus não mutado encontrada é maior do que um valor limiar, e preferencialmente dito valor limiar é específico de um dado polimorfismo genético e é determinado a partir de um grupo de pacientes com e sem dita mutação; e-a determinação do índice de integridade do dito ácido nucleico livre de célula na amostra, por um método de acordo com a presente invenção, b) combinar pelo menos dois valores por meio de uma função logística incluindo ditos pelo menos dois biomarcadores, e c) análise do dito valor final da dita função logística a fim de diagnosticar ou prognosticar o estado patológico ou fisiológico, tal como um tumor ou progressão do tumor no dito paciente. [0143] In another aspect, the present invention is directed to a method for the diagnosis, prognosis of a pathological or physiological state, such as the presence of a tumor or the progression of the tumor in a patient, or a teragnotic method that comprises the determination of said pathological or physiological state in a patient, and said pathological or physiological state is associated with a genetic polymorphism in a nucleic acid (such as a SNP or mutation), in which said method comprises the steps of: a) study of at least two biomarkers selected from the group of: - determining the concentration of cell-free nucleic acid in a sample of body fluid from said patient by a method of quantifying cell-free nucleic acid according to the present invention; -The detection of a genetic polymorphism in said cell-free nucleic acid by a method according to the present invention, in which the classification of the patient as having or not said genetic polymorphism is obtained by determining whether the percentage of mutated cell-free nucleic acid versus mutant found is greater than a threshold value, and preferably this threshold value is specific to a given genetic polymorphism and is determined from a group of patients with and without said mutation; and - determining the integrity index of said cell-free nucleic acid in the sample, by a method according to the present invention, b) combine at least two values using a logistic function including said at least two biomarkers, and c) analysis of said final value of said logistic function in order to diagnose or predict the pathological or physiological state, such as a tumor or tumor progression in said patient.
[0144] [0144] Such threshold value associated with said SNP in the present method of the invention when necessary can be determined from a cohort of two groups of patients, patients who exhibit and patients who do not exhibit the specific genetic polymorphism (such as SNP or mutation) associated with said SNP. Said threshold represents the minimum value, above which it is unambiguously established that the gene is mutated.
[0145] a) um primeiro conjunto de dois primers, denominados de A1 (primer direto) e A2 (primer reverso), e ditos dois primers A1 e A2: -Possuem um tamanho mínimo de 15 nucleotídeos e um tamanho máximo de 30 nucleotídeos; e-possuem um espaçamento mínimo de pelo menos 5 pb entre os dois primers, entre as extremidades 3' de ambos primers, e-permitem a obtenção de um fragmento amplificado (amplicon) possuindo uma faixa de tamanho compreendido entre 35 e 100 pb, estando dito amplicon em uma região do dito gene que não apresenta a mutação de interesse; e b) um segundo conjunto de dois primers, denominados de B1 (primer direto) e B2 (primer reverso), e ditos dois primers B1 e B2: -Possuem um tamanho mínimo de 15 nucleotídeos e um tamanho máximo de 30 nucleotídeos; e-possuem um espaçamento mínimo de pelo menos 5 pb entre os dois primers, entre as extremidades 3' de ambos primers, e-permitem a obtenção de um fragmento amplificado (amplicon) possuindo uma faixa de tamanho compreendido entre 35 e 100 pb, estando dito amplicon em uma região do dito gene que apresenta a mutação de interesse; e em que A1B2 esta na faixa de tamanho de 250-450 pb.[0145] The present invention is also directed to a kit comprising two sets of nucleic acid primers, preferably for the detection or quantification of the presence of a cell-free nucleic acid of a gene of interest in a body fluid sample, and said gene of interest is likely to present a mutation, more preferably, for its use in the IntPlex system of the present invention, characterized by the fact that the two sets of primers comprise: a) a first set of two primers, called A1 (direct primer) and A2 (reverse primer), and said two primers A1 and A2: -Have a minimum size of 15 nucleotides and a maximum size of 30 nucleotides; and - have a minimum spacing of at least 5 bp between the two primers, between the 3 'ends of both primers, and -allow to obtain an amplified fragment (amplicon) having a size range between 35 and 100 bp, being said amplicon in a region of said gene that does not have the mutation of interest; and b) a second set of two primers, called B1 (direct primer) and B2 (reverse primer), and said two primers B1 and B2: -Have a minimum size of 15 nucleotides and a maximum size of 30 nucleotides; and - have a minimum spacing of at least 5 bp between the two primers, between the 3 'ends of both primers, and -allow to obtain an amplified fragment (amplicon) having a size range between 35 and 100 bp, being said amplicon in a region of said gene that presents the mutation of interest; and where A1B2 is in the 250-450 bp size range.
[0146] [0146] The present invention is also directed to the kit according to the present invention, in which: the target region of said gene of interest when primer B2 is located 5 to 85 nucleotides downstream of the position of said mutation of interest the region of said gene of interest when the A1A2 primer pair is designed in the region which is located within the 430-100 nucleotides upstream of the position of said mutation of interest, preferably for use in the conventional IntPlex system of the present invention.
[0147] [0147] The present invention is also directed to the kit according to the present invention, in which: the region of said gene of interest when primer A1 is located 5 to 85 nucleotides upstream of the position of said mutation of interest. the region of said gene of interest when the primer pair B1B2 is designed for the region located within the 100-430 nucleotides upstream of the position of said mutation of interest, preferably for use in the reverse IntPlex system of the present invention.
[0148] [0148] The present invention is also directed to a kit comprising two sets of nucleic acid primers according to the present invention, in which the gene and / or the associated gene mutation is / are selected from from the group of: A) Mutations in specific cancer disorders :: (For each gene, the position number in the cDNA of the bp that carry the mutation based on the NCBI 36 is shown. Ensembl Contig view <http://may2009.archive.ensembl.org/Homo_sapiens/Location/) TP53: 394, 395, 451,453, 455, 469, 517, 524, 527, 530, 586, 590, 637, 641, 724, 733,734, 743, 744, 817, 818,819, 820, 839, 844, 916 APC: 2626, 3340, 3907, 3934, 3964, 4012, 4099, 4132, 4133, 4285, 4286, 4348, 4729 MSH6: 1168 NF1: 3827, 3826 PIK3CA: 1530, 1624, 1633, 1634, 1636, 1656, 3140, 3140, 3140 SMAD4: 502, 931, 932, 988, 989, 1051, 1082, 1156, 1332, 1333, 1519, 1596, 1597, 1598, 1606 EGFR: 2155, 2155, 2156, 2303, 2369, 2573; deletions / loss: 2230 to 2244, from 2308 to 2328 CDKN2A: 172, 205, 238, 239, 298, 250, 322, 369, 427, 394 HDI1: 394; 395 PTEN: 125, 126,182, 302, 314, 387, 388,389, 1911, 577, 518, 519, 697, 698, 1003, 1004 SMARCB1: 118, 153, 154, 379, 380, 425, 471, 472, 473, 601, 618, 619, 777, 776, 778 CTNNB1: 7, 94, 95, 98, 100, 101, 110, 121, 122 , 133, 134, 170 HNF1A: 82, 81, 83,196, 378, 379, 493, 494, 495, 526,527, 617, 618, 685, 710, 749, 787, 817 VHL: 194, 203, 241,266, 340, 343, 388, 452, 473, 480, 478 ATM: 1229, 1810, 2571,2572, 2573, 3925, 8774, 9023 EZH2: 1936, 1937 RET: 2753 NRAS: 181, 182, 183 PTCH1: 135, 338, 416, 417, 1242, 1243, 1244, 1280 1281, 1284, 1301, 1302, 1315 KIT: 1668, 1669, 1670, 1679, 1680, 1681, 1682, 1727, 1728, 1924, 1925, 1961, 1962, 2467, deletions from 1645 to 1727 NF2: 168, 169, 170, 459, 460, 586, 592, 634, 655, 656, 784, 1021, 1022, 1396 PDGFRA: 1680, 1681, 1682, 1975, 1976, 1977 MEN1: 124, 256, 291,292, 293 PPP2R1A: 536, 767 STK11: 196, 910 MLL3: 1097, 4432, 6301, 6851, 8911, 10040, 10495, 12048, 12165 FOXL2: 402 GNAS: 601,602, 680 HRAS: 34, 35, 36, 37, 39, 181,182 FGFR3: 742, 743, 744, 746, 1108, 1111, 1112, 1113, 1114, 1115, 1116, 1117, 1118, 1949 PTCH1: 549, 550, 584, 1093, 1249, 1804, 2446, 3054, 3944, 3945, 3946 CDH1: 367,368, 1000, 1057, 1108, 1204, 1436, 1437, 1742; B) Mutation in disorders other than cancer: a) single gene disorders
[0149] b) Autossômica alelo recessiva: fibrose cística, anemia falciforme, doença de Tay-Sachs, doença de Niemann-Pick, atrofia muscular espinhal, síndrome de Roberts, Fenilcetonúria, Mucopolissacaridoses, doenças de armazenamento de glicogênio; c) ligada ao X dominante: síndrome de Rett, incontinência pigmentar, síndrome de Aicardi, síndrome de Klinefelter, incontinência pigmentar, distrofia muscular de Duchenne, hemofilia; d) ligada ao Y: infertilidade masculina e hipertricose auricular; e) doença mitocondrial: neuropatia óptica hereditária de Leber; f) distúrbios multifatoriais e poligênicos (complexos): asma, doenças autoimunes como a esclerose múltipla, câncer, ciliopatias, fenda palatina, diabetes, doença cardíaca, hipertensão, doença inflamatória intestinal, retardo mental, transtorno de humor, obesidade, erro refrativo, infertilidade; [0149] Autosomal dominant gene: familial hypercholesterolemia, Huntington's disease, neurofibromatosis type 1, Marfan syndrome, non-hereditary polyposis, colorectal cancer, hereditary multiple exostoses, polycystic kidney disease, achondroplasia, sickle cell anemia, achondroplasia, sickle cell anemia b) Autosomal recessive allele: cystic fibrosis, sickle cell anemia, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, Roberts syndrome, Phenylketonuria, Mucopolysaccharidoses, glycogen storage diseases; c) linked to the dominant X: Rett syndrome, pigmentary incontinence, Aicardi syndrome, Klinefelter syndrome, pigmentary incontinence, Duchenne muscular dystrophy, hemophilia; d) Y-linked: male infertility and atrial hypertrichosis; e) mitochondrial disease: Leber's hereditary optic neuropathy; f) multifactorial and polygenic (complex) disorders: asthma, autoimmune diseases such as multiple sclerosis, cancer, ciliopathies, cleft palate, diabetes, heart disease, hypertension, inflammatory bowel disease, mental retardation, mood disorder, obesity, refractive error, infertility ;
[0150] [0150] The present invention is also directed to the kit comprising two sets of nucleic acid primers according to the present invention, in which the gene mutation of interest is selected from the group consisting of the mutations of the KRAS and BRAF genes , and particularly the V600E mutation in the BRAF gene.
[0151] a) um primeiro conjunto de dois primers, denominados de A1 (primer direto) e A2 (primer reverso), e ditos dois primers A1 e A2 são selecionados a partir do grupo que consiste em: - para A1, as SEQ ID NOs 163 a 196,- para A2, as SEQ ID NOs 250 a 256; e/ou b) um segundo conjunto de dois primers, denominados de B1 (primer direto) e B2 (primer reverso), e ditos dois primers B1 e B2 são selecionados a partir do grupo que consiste em: -para B1, as SEQ ID NOs 244 a 249;-para B2, as SEQ ID NOs 83 a 120.[0151] The present invention is directed to a kit comprising one or two sets of nucleic acid primers, preferably for the detection or quantification of the presence of a KRAS gene cell-free nucleic acid in a body fluid sample, in which said KRAS gene is likely to present a mutation selected from the G12 mutation group of KRAS, preferably the mutations, G12V, G12D, G12A, G12S and G12C, and G13D, more preferably, for its use in the IntPlex system, characterized by the fact of which said set of primers or the two sets of primers comprise: a) a first set of two primers, called A1 (direct primer) and A2 (reverse primer), and said two primers A1 and A2 are selected from the group consisting of: - for A1, SEQ ID NOs 163 to 196, - for A2, SEQ ID NOs 250 to 256; and / or b) a second set of two primers, called B1 (direct primer) and B2 (reverse primer), and said two primers B1 and B2 are selected from the group consisting of: -for B1, SEQ ID NOs 244 to 249; -for B2, SEQ ID NOs 83 to 120.
[0152] a) um primeiro conjunto de dois primers, denominados de A1 (primer direto) e A2 (primer reverso), e ditos dois primers A1 e A2 são selecionados a partir do grupo que consiste em: -para A1, as SEQ ID NOs 65 a 81,-para A2, a SEQ ID NO 19; e/ou b) um segundo conjunto de dois primers, denominados de B1 (primer direto) e B2 (primer reverso), e ditos dois primers B1 e B2 são selecionados a partir do grupo que consiste em: -para B1, a SEQ ID NO: 38;-para B2, as SEQ ID NOs 40 a 63.[0152] The present invention is also directed to a kit comprising one or two sets of nucleic acid primers, preferably for detecting or quantifying the presence of a BRAF gene cell-free nucleic acid in a body fluid sample, and said BRAF gene is likely to have a V600E mutation, preferably for use in the IntPlex system, characterized by the fact that the one or two set (s) of primer (s) comprises: a) a first set of two primers, called A1 (direct primer) and A2 (reverse primer), and said two primers A1 and A2 are selected from the group consisting of: -for A1, SEQ ID NOs 65 to 81, -for A2, SEQ ID NO 19; and / or b) a second set of two primers, called B1 (direct primer) and B2 (reverse primer), and said two primers B1 and B2 are selected from the group consisting of: -for B1, SEQ ID NO: 38; -for B2, SEQ ID NOs 40 to 63.
[0153] [0153] In another aspect, the present invention is directed to a nucleic acid primer, preferably for the detection or quantification of the presence of a cell-free KRAS DNA containing a sequence from the same intronic KRAS region in a body fluid sample , preferably for determining the size profile of said cell-free nucleic acid in a sample of body fluid from a patient, and said nucleic acid is selected from the group of primers that have the sequences of SEQ ID NOs: 1 to 8 (see table 1).
[0154] a) um conjunto de primers compreendendo o primer possuindo a sequência de SEQ ID NO: 1; e pelo menos dois primers diferentes, preferencialmente três primers diferentes selecionando a partir do grupo de primers possuindo as sequências de SEQ ID NOS: 2 a 8; b) um conjunto de primers compreendendo o primer possuindo a sequência de SEQ ID NO: 1, o primer possuindo a sequência de SEQ ID NO: 8, e pelo menos um ou dois primers selecionados a partir do grupo de primers possuindo as sequências de SEQ ID NOs: 2 a 7; c) um conjunto de primers compreendendo o primer possuindo a sequência de SEQ ID NO: 1, o primer possuindo a sequência de SEQ ID NO: 7, e um primer selecionados a partir do grupo de primers possuindo as sequências de SEQ ID NOs: 2 a 6; e d) um conjunto de primers compreendendo os primers que possuem as sequências de SEQ ID NOs: 1 a 8. [0154] The present invention is also directed to a set of nucleic acid primers, preferably for the detection or quantification of the presence of a cell-free KRAS nucleic acid in a body fluid sample, more preferably of KRAS DNA, in which said primer set is selecting from the group of the following primer sets: a) a set of primers comprising the primer having the sequence of SEQ ID NO: 1; and at least two different primers, preferably three different primers selecting from the group of primers having the sequences of SEQ ID NOS: 2 to 8; b) a set of primers comprising the primer having the sequence of SEQ ID NO: 1, the primer having the sequence of SEQ ID NO: 8, and at least one or two primers selected from the group of primers having the sequences of SEQ ID NOs: 2 to 7; c) a set of primers comprising the primer having the sequence of SEQ ID NO: 1, the primer having the sequence of SEQ ID NO: 7, and a primer selected from the group of primers having the sequences of SEQ ID NOs: 2 to 6; and d) a set of primers comprising the primers that have the sequences of SEQ ID NOs: 1 to 8.
[0155] [0155] The present invention is also directed to a set of nucleic acid primers, preferably for use in the IntPlex system to demonstrate the presence of the G12V KRAS mutation in a body fluid sample, and said set of nucleic acid primers comprises primers having the sequences of SEQ ID NOs: 9 to 14, preferably 9 to 15 (see table 2).
[0156] [0156] More preferably, the present invention is directed to a set of nucleic acid primers, preferably for use in the IntPlex system to demonstrate the presence of the KRAS G12 mutation (G12V, G12D, G12A, G12S and G12C) and the G13D mutation in a body fluid sample, and said set of nucleic acid primers comprises primers having the sequences of SEQ ID NOS: 28 to 36, preferably 29 to 37 (see table 4).
[0157] [0157] The present invention is finally directed to a set of nucleic acid primers, preferably for use in the IntPlex system to demonstrate the presence of the V600E mutation in BRAF in a body fluid sample, and said set of nucleic acid primers comprises the primers having the sequences of SEQ ID NOs: 16 to 21, preferably from 16 to 22 (see table 2).
[0158] [0158] More preferably, the present invention is directed to a set of nucleic acid primers, preferably for use in the IntPlex system to demonstrate the presence of the V600E mutation in BRAF in a body fluid sample, and said set of body primers. Nucleic acid comprises primers having the sequences of SEQ ID NOs: 23 to 26, preferably 23 to 27 (see table 4).
[0159] [0159] Finally, the present invention is directed to a kit for the detection or quantification of the presence of cell-free BRAF KRAS nucleic acid in a body fluid sample, more preferably cell-free DNA, optionally cell-free DNA exhibiting a genetic polymorphism, or determining the size profile of said cell-free BRAF KRAS nucleic acid in a biological sample, said kit comprising a set of primers as indicated above according to the present invention.
[0160] [0160] The following examples, as well as the following figures and captions, were chosen to provide the skilled technicians in the subject with a complete description in order to enable the execution and use of the present invention. These examples are not intended to limit the scope that the inventor considers his invention to be, nor are they intended to demonstrate that only the following experiments were performed. BRIEF DESCRIPTION OF THE FIGURES
[0161] [0161] Figure 1: Q-PCR quantification of genomic DNA isolated from CRC (colorectal cancer) HCT-116-s cells using primer pairs that lead to amplification of amplicons of different sizes of the KRAS gene. The values are obtained by quantifying a sample at a dilution that corresponds to 45 pg / µL The concentration of the genomic DNA sample was measured by optical density before use in Q-PCR. The histograms represent the mean values of three different experiments. The experiments were carried out in duplicates and the results are expressed in pg / µL of extract.
[0162] [0162] Figures 2A and 2B: Quantification by Q-PCR of cirDNA isolated from 3 patients with metastatic CRC before surgery and chemotherapy due to the size of the amplicon. Figure 2A, serum samples (n = 2 patients). Figure 2B, plasma sample from a patient. The determination of the cirDNA concentrations of each patient was performed in duplicates. The histogram corresponds to the average of the duplicates. The results are expressed in ng / µL of cirDNA.
[0163] [0163] Figure 3: Q-PCR quantification of cirDNA isolated from plasma samples from three healthy individuals aged 20 to 25 years. The concentration of cirDNA was determined using a Q-PCR system that amplifies fragments of dimensions ranging between 60-409 bp. The histograms show the mean values expressed in pg cirDNA / mL of plasma. For example, the maximum value obtained with the KRAS 101 primer pair corresponds to a plasma concentration of 4.8 ng / ml.
[0164] [0164] Figure 4: Illustration of the advantage in amplifying the short DNA sequence due to the detection of mutated ctDNA. The use of three sets of primers (A, B and C), producing amplicons of different sizes is represented when analyzing genomic DNA, little and very fragmented DNA.
[0165] [0165] Figure 5: The relative proportions of the concentration values in relation to the size of the amplicon.
[0166] [0166] Figure 6: CirDNA concentrations obtained by amplifying a 249 bp long fragment or a 60 bp short fragment in plasma samples from a healthy individual with a low level of cirDNA (23 ng / ml plasma), a subject with mCRC with intermediate level of cirDNA (450 ng / ml plasma) and a patient with mCRC with high concentration of cirDNA (1860 ng / ml plasma). The cell line sample corresponds to the values obtained for genomic DNA isolated from HCT116-S cells (4.8 ng / ml, Figure 1). The values are expressed as fractions of the maximum value obtained with the primer pairs for the amplification of DNA fragments of increasing sizes (60, 73, 101, 145, 185, 249, 300, 357 and 409 bp).
[0167] [0167] Figures 7A and 7B: The concentration of tumor-specific ctDNA by the size profile in xenografted mice. Two series of 7 sets of primers were used, generating amplicons with increasing lengths between 60 and 409 bp or 60 and 385 bp of human or mouse origin, respectively. Each point corresponds to the average of three groups of four different mouse plasmas.
[0168] [0168] Figures 8A and 8B: The contribution of the amount of tumor cirDNA to total cirDNA in the plasma of xenografted mice.
[0169] [0169] Figure 9: Schematic representation of an example of using the IntPlex method for the analysis of SNPs.
[0170] [0170] Figure 10: Application of the IntPlex system for cancer.
[0171] [0171] Figures 11A and 11B:
[0172] [0172] Figure 11A: Schematic representation of the conventional IntPlex KRAS system in which the mutation is at the 3 'end of primer sense B1.
[0173] [0173] Figure 11B: Schematic representation of the Reverse KRAS IntPlex system in which the mutation is at the 3 'end of the A2 antisense primer.
[0174] [0174] Figure 12: Efficiency of the Kinv system for the quantification of cirDNA from mice xenografted with human cancer cells SW620. Red numbers: size of the amplicons (in bp).
[0175] [0175] Figure 13: Efficiency of the Kconv system for the quantification of cirDNA from mice xenografted with human cancer cells SW620. Red numbers: size of the amplicons (in bp).
[0176] [0176] Figure 14: Q-PCR quantification of the S4 HT29 DNA.
[0177] [0177] Figure 15: S4 HT29DNA diluted (1/10) in human genomic DNA.
[0178] [0178] Figure 16: Data are presented as a percentage of the highest concentration in the series.
[0179] [0179] Figure 17: Concentrations of mutated fragments (in%) as a function of the concentration of mutated fragments observed using the IntPlex process from human plasma DNA.
[0180] [0180] Figure 18: Discrimination of plasma between healthy and CRC individuals. The cirDNA concentration values are shown in the table and expressed in ng / mL of plasma. Histograms represent the% of the amount of cirDNA contained in the size fraction.
[0181] [0181] Figures 19A - 19B: Electrophoresis in agarose gel of 20 μg of ctDNA extracted from two patients with CRC (CRC021, Fig 19A and CRC019, Fig. 19B).
[0182] [0182] Figure 20: Comparison of the DII (A) values from genomic DNA, and ctDNA from human plasmas (healthy and CRC).
[0183] [0183] Figure 21: Comparison of the DII values calculated with the designed primers of the present invention, with the value obtained by using pairs of primers that target distant DNA sequences.
[0184] [0184] Figures 22A - 22E: Determination of several parameters indicating the size pattern of the ctDNA fragment (the data are represented graphically in histograms).
[0185] [0185] Figure 23: Location of primer sequences for the BRAF gene (conventional and reverse (or inverse) system).
[0186] [0186] Example of the DNA region to be targeted by the IntPlex method when the V600E point mutation in BRAF is of interest. Figure 23 shows the regions where molecular entities, such as primers, can be targeted in our multiplex method applied to this mutation. Yellow: conventional system; Green: reverse system; Red: blocker; Pink: SNP. Figures 24A - 22E: Location of exon 2 regions and primer sequences for the KRAS gene (conventional and reverse (or inverse) system).
[0187] [0187] Figure 24A: Example of DNA region to be targeted in the IntPlex method when point mutations in the hot spots of the 2nd and 3rd codons of the second exon of the KRAS gene are of interest.
[0188] [0188] Yellow: reverse primer for the mutated amplicon: 6156 to 6236;
[0189] [0189] Green: primer pair for unmuted amplicon: 5721 to 6051
[0190] [0190] Figure 24A shows the regions where molecular entities, such as primers, can be targeted in the multiplex method applied to this mutation.
[0191] [0191] Figure 24B: Location of KRAS primer sequences in conventional and reverse systems.
[0192] [0192] Yellow: conventional system;
[0193] [0193] Green: reverse system;
[0194] [0194] Red: blocker;
[0195] [0195] Pink: SNP.
[0196] [0196] Figure 24C: DNA region selected as a target for the B1B2 primer pair designed for the detection of hot spot mutations in exon 2 of KRAS in the reverse configuration of the system of the present invention. A1: GCCTGCTGAAAATGACTG; A2: and yellow and green.
[0197] [0197] Figure 24E: DNA region selected as target for primer A1 to detect mutations in the hot spot in KRAS exon 2 in the reverse configuration:
[0198] [0198] A2: GTGGCGTAGGCAAGAGTGCCTT;
[0199] [0199] A1: DNA region selected as a target in yellow and green.
[0200] [0200] Figure 24D: DNA region selected as target for primer B2 to detect hot spot mutations in KRAS exon 2 in the conventional configuration:
[0201] [0201] B1: ACTTGTGGTAGTTGGAGCTGG
[0202] [0202] B2: DNA region selected as a target in yellow and green. EXAMPLES EXAMPLE 1 DETERMINATION OF THE STRIP SIZE RANGE
[0203] [0203] In order to determine the ideal size of the amplicons for a more specific and sensitive analysis of cirDNAs by Q-PCR, we have prepared and used 9 pairs of primers that allow amplification of amplicons with 60, 73, 101, 145,185, 249 , 300, 357 and 409 bp within the same region. They were designed in such a way that a small amplicon is always included within the sequence of a larger amplicon, the antisense primer is the same for each pair of primers. This 409 bp amplified region is located at intron 2 of the KRAS. The sequences of the oligonucleotide primers are shown in Table 1.
[0204] [0204] Figure 1 describes the variation in the performance of the tested primer pairs. All results are from three experiments performed in duplicates. The efficiency of the Q-PCR amplification reaction of a given DNA sequence is related to the thermodynamic properties of the primers and it differs, among other things, depending on the size of the amplicon. As shown in Figure 1, the detection efficiency of the primer pairs (with similar hybridization properties) is due to the size of the tested amplicons. As illustrated in Figure 1, the detection appears to be optimal for amplicons with sizes between 101 and 185 bp. In the literature, amplification of regions ranging from 150 to 250 bp has been conventionally chosen.
[0205] [0205] The presence of monomers or multiple nucleosomes that have a size of about 180-200 bp has already been described and is indicative of an apoptosis mechanism for the release of cirDNA.
[0206] [0206] Figure 2A summarizes the results obtained with two serum samples from two patients with metastatic colorectal cancer (mCRC). The cirDNA concentration curves of these two serum samples show comparable profiles that have approximately three phases. The first, in which the concentration of amplicons of sizes between 60 and 73 bp (up to values ranging between 0.2 and 0.3 ng / µL) is similar, a second for amplicons of sizes between 101 and 145 bp, where the concentration decreases sharply to values of about 0.05 ng / μL and, finally, a third phase of amplicons of sizes between 145 and 409 bp, in which the concentration of cirDNA forms a plateau or decreases very slowly to 0.02 ng / µL.
[0207] [0207] Figure 2B shows the concentration of cirDNA determined by the use of the same amplification system with amplicons of increasing sizes in the plasma of a patient with CRC. The data shows the same size profile.
[0208] [0208] It should be noted that the sera and plasma used are from patients waiting for their first tumor resection surgery and not undergoing chemotherapy at the time of sampling.
[0209] [0209] Figure 3 summarizes the profiles of cirDNA concentration in plasma samples from healthy individuals with reason for amplicon sizes. These results indicate that the highest concentrations of cirDNA are detected with amplicons ranging in size from 101 to 145 bp. Unlike the results for patients with mCRC, in healthy individuals the results do not indicate the presence of a significant variation in the detection of amplicons greater or less than 101-145 bp.
[0210] [0210] We can discriminate plasma from cancer patients from plasma from a healthy individual, comparing quantification of cfDNA by detecting an amplified sequence (amplicon) of 145-409 and another in the size range of 50-73 bp. A long / short ratio <0.5 and preferably <0.1 is indicative of the presence of a tumor. THE REASON WHY THE SIZE OF AMPLICON IS CRUCIAL IN THE ANALYSIS OF CIRDNA VS GENOMIC DNA
[0211] [0211] Thus, the cirDNA size profile, as determined by amplicon amplification having increasing sequence lengths, reveals that optimal detection is made when amplicon amplification is <100 bp, and that a much larger proportion of cirDNA with sizes ranging between 150 and 350 bp are present in non-tumor cirDNA when compared to tumor cirDNA. The choice of the size of the amplified DNA region therefore appears crucial as illustrated by the scheme in figure 4.
[0212] - a sensibilidade da análise pela Q-PCR (um aumento de mais de 10 vezes e até 50 vezes de acordo com a quantidade de cirDNA na amostra), -a especificidade, pois a análise do perfil de concentração do cirDNA baseada no tamanho do amplicon (ou a determinação da amplificação ótima) pode distinguir o cirDNA de um paciente com mCRC do cirDNA de um indivíduo saudável. A medida da razão entre a quantificação obtida por amplicons de tamanhos entre 50 e 100 e a quantificação obtida por amplicons maiores do que 100 pb pode ser usada para a hipótese da presença de cirDNA de origem tumoral. Além da quantidade total mais elevada de cirDNA em pacientes com mCRC, a qualidade em termos de tamanho do fragmento aparece, pela primeira vez, como sendo específica e informativa sobre a presença de cirDNA de câncer. [0212] Thus, the choice of amplicon size is crucial for: - the sensitivity of the analysis by Q-PCR (an increase of more than 10 times and up to 50 times according to the amount of cirDNA in the sample), -the specificity, as the analysis of the cirDNA concentration profile based on the size of the amplicon (or the determination of optimal amplification) can distinguish the cirDNA of a patient with mCRC from the cirDNA of a healthy individual. The measure of the ratio between the quantification obtained by amplicons of sizes between 50 and 100 and the quantification obtained by amplicons larger than 100 bp can be used for the hypothesis of the presence of cirDNA of tumor origin. In addition to the higher total amount of cirDNA in patients with mCRC, the quality in terms of fragment size appears, for the first time, to be specific and informative about the presence of cancer cirDNA.
[0213] [0213] In addition, it is possible to determine its specificity by measuring the integrity index, which is calculated by comparing the concentrations of amplicons of specific sizes (Figure 5).
[0214] [0214] The 145/60 or 300/60 ratio is always less than 1, in the case of analysis of the cirDNA of patients with mCRC. On the other hand, the 145/60 ratio is 2.07 for genomic DNA.
[0215] [0215] The integrity index for 300/60 is lower than for 145/60 in the cirDNA of patients with mCRC. In fact, it is <0.344 in mCRC patients, while it is> 0.45 in the cirDNA of healthy individuals. The 300/60 ratio is 0.38 in the genomic DNA.
[0216] [0216] The initial study of the analysis of the ratio 145/60 and 300/60, in healthy individuals and patients with mCRC, shows a sensitivity of 100% and a specificity of 100%. The 145/60 ratio thus seems to discriminate better between healthy individuals and patients with mCRC than the 300/60 ratio, especially when the standard deviation from the mean is considered, but it has less differentiation when the specificity is considered. The 300/145 ratio is not optimal for discriminating healthy patients / cancer and, in general, provides results that are opposite to those obtained with the 300/60 ratio, that is, the average of the values obtained for 300/145 is higher for the cirDNA of patients with mCRC; however, this is the type of ratio (short fragment> 100 bp and <180), which has been conventionally used in the few previous studies on the integrity index (13-19).
[0217] [0217] It is important to indicate that the choice of primer pairs used (and thus, in particular, the size of the amplified sequence) for the detection of cirDNA is based only on its amplification yield of fragments between 100 and 300 bp of according to the target sequence. The calculation of the health indexes can be used to discriminate between cirDNAs of healthy individuals and patients with mCRC. It should be noted that other relationships (reasons) or integrity indexes can be calculated depending on the development of the tumor or the total concentration of cirDNA.
[0218] [0218] The histograms in Figure 5 show that the relative proportions of the values obtained with the amplification of the 60 and 145 bp fragments are opposite in healthy individuals when compared to patients with mCRC.
[0219] [0219] We found that the greater the amount of cirDNA, the lower the integrity index. For example, the 249 bp long fragment amplification value decreases while the 60 bp short fragment amplification increases as a function of the total amount of cirDNA (Figure 6).
[0220] 1. O tamanho do fragmento amplificado (amplicon) influencia grandemente a quantificação de cfDNAs. 2. A detecção de amplicons menores que 100 pb é o ideal. 3. A determinação de um índice de integridade pode ser utilizada para discriminar entre o cirDNA de um sujeito com mCRC e o cirDNA de um indivíduo saudável e também o DNA genômico. 4. A comparação dos resultados da amplificação por PCR de extratos de cirDNA pode ser realizada com precisão apenas comparando a amplificação de pares de primers que produzem amplicons de tamanhos idênticos. [0220] In summary, the results of this example allow for the first time to determine innovative characteristics with reason for the detection of cfDNA by Q-PCR: 1. The size of the amplified fragment (amplicon) greatly influences the quantification of cfDNAs. 2. The detection of amplicons less than 100 bp is ideal. 3. The determination of an integrity index can be used to discriminate between the cirDNA of a subject with mCRC and the cirDNA of a healthy individual and also genomic DNA. 4. The comparison of the results of the PCR amplification of cirDNA extracts can be performed accurately only by comparing the amplification of pairs of primers that produce amplicons of identical sizes.
[0221] [0221] CRC cells; SW620 were maintained in RPMI + 10% fetal bovine serum. SW620 cells have the homozygous mutation G12V in KRAS (GGT for GTT). b) Xenograft model
[0222] [0222] Female athymic nude mice (6-8 weeks old) were xenografted subcutaneously with 1x106 cancer cells. The mice were sacrificed with CO2 three weeks after the graft, and the weight of the tumors was between 300-650 mg. Peripheral blood was collected in tubes with EDTA and immediately (within an hour) used for the preparation of plasma. c) Preparation of plasma and serum
[0223] [0223] After collection in 5 mL tubes “BD vacutainer KE35" (Belliver Industrial), the blood samples of the mice were centrifuged at 2000 rpm at 4 ° C, in a Heraeus LR Multifuge centrifuge with a 4j CR rotor for 10 The supernatants were collected in 1.5 ml sterile Eppendorf tubes and centrifuged at 14000 rpm (16,000 g) at 4 ° C for 10 min. Then the supernatants were either immediately handled for DNA extraction or stored at -80 ° C. No significant difference was found in the Q-PCR assays comparing isolated fresh plasma or stored plasma.The serum was prepared using the same 2-step centrifugation process, but the blood was collected in tubes without EDTA, and then were left at room temperature for one hour Plasma and sera from mice and humans were isolated in 3 hours after collection. d) DNA extraction
[0224] [0224] The ctDNA and genomic DNA from different cell lines were extracted following the same procedure. The DNA was purified from 200 μL of plasma using the extraction kit 'QIAmp DNA mini Blood kit' (Qiagen, CA) following the protocol 'Blood and body fluid protocol', with an elution volume of 60 μL. The samples were maintained at 4 ° C during plasma preparation. DNA samples were frozen at -20 ° C until use. No significant difference was found in the Q-PCR assays comparing fresh or stored DNA. e) Quantification of ctDNA by Q-PCR
[0225] [0225] DNA was quantified by the Q-PCR assay. Real-time PCR amplifications were performed in a 25 μL reaction volume on a MyiCycler IQ 5IQ instrument or a Chromo4 instrument using the IQ5 software 2.0 optical system and the MJ Opticon Monitor 3 (Bio-Rad) software. Each PCR reaction mixture consisted of 12.5 μL of PCR mix (Bio-Rad Super mix SYBR Green = Taq polymerase, MgCl2), 2.5 μL of each of the amplification primers (100 pmol / μL), 2 , 5 μL of water analyzed by PCR and 5 μL of extracted DNA. Thermal cycling started with a first denaturation step of 3 min at 95 ° C, followed by 40 cycles of 95 ° C for 10 seconds and 60 ° C for 30 seconds. Melting curves were obtained from 55 ° C to 90 ° C with readings every 0.2 ° C. As calibrators for quantification, serial dilutions of genomic DNA from HCT116-S cells and MC38 cells were used. The sample concentrations were extrapolated from the standard curve by the software system QI 5 Optical 2.0 or MJ Opticon Monitor 3. The detection limit, such as the concentration that can be detected with reasonable certainty (a 95% probability), as recommended in the MIQE guidelines, was 3 copies / trial (21).
[0226] [0226] The plasma extract was assayed by amplifying the same 60-409 bp DNA sequences from human KRAS intron 2 as previously used for the analysis of the clinical CRC sample. In addition, non-tumor cirDNA was tested by the same method by amplification with the 60-385 bp DNA sequences from mouse KRAS intron 1. Plasma extracts from non-xenografted nude control mice were also tested using this method.
[0227] [0227] Figures 7A and 7B first show that significant discrimination between tumor-derived and non-tumor-derived cirDNA by sequence amplification varies between 200 and 300 bp. Second, the concentration was found to be maximal when amplification of the <100 bp region for tumor cirDNA is achieved, although maximum amplification was achieved when the 105 bp sequence was amplified for non-tumor cirDNA and 60 bp for tumor cirDNA .
[0228] [0228] The determination of the cirDNA integrity index (300/60) is therefore much lower for tumor cirDNA than for non-tumor cirDNA and non-xenograft control mouse cirDNA; being 0.05 when compared to 0.57 and 0.48, respectively.
[0229] [0229] Figures 8A and 8B show the contribution of the amount of tumor ctDNA compared to the amount of total cirDNA (amount of tumor + non-tumor cirDNA) from the data obtained in the same experiment. The data clearly shows that the proportion of tumor cirDNA decreased markedly from the 60250 bp amplified region and then became more or less stabilized.
[0230] [0230] These observations confirm the results previously obtained with the analysis of human samples.
[0231] [0231] In addition, the data show the difference between the concentration profiles due to the length of the amplicon between tumor versus non-tumor / control cirDNA. EXAMPLE 3 INTPLEX METHOD GENERAL APPLICATION OF INTPLEX ANALYSIS
[0232] [0232] CirDNAs carry genetic marks from healthy and pathological cells, or from infectious agents. Thus, genetic alterations are targets of choice due to their clinical repercussions. One of the technical challenges due to cirDNAs is the use of them as a tool to detect genetic polymorphisms, especially SNPs (single nucleotide polymorphisms).
[0233] [0233] SNPs are the most abundant genetic variations in the human genome. They represent more than 90% of all differences between individuals. It is a type of DNA polymorphism in which two chromosomes differ over a given segment by a single base. In two random human genomes, 99.9% of DNA sequences are identical. The remaining 0.1% includes sequence variations, where the most common type is a single nucleotide polymorphism (SNP). SNPs are stable, very abundant and uniformly distributed throughout the genome. These variations are associated with diversity within a population or between individuals, with differences in susceptibility to disease and individual response to drugs. Some are responsible for cell cycle disturbances, which can result in cell proliferation and, ultimately, cancer development.
[0234] [0234] Most methods for the analysis of SNPs are based on the possibility of DNA denaturation in single strand chains by heating and renaturation by cooling under precise conditions to a strand that has a complementary sequence (PCR methods). Thus, PCR allows the identification and quantification of a DNA sequence through the analysis of its amplification thanks first to a specific polymerase, and also to specific oligonucleotides that will "delimit" the sequence to be amplified.
[0235] [0235] PCR was previously adapted to detect SNP. One of the simplest known PCR methods for detecting SNPs is allele-specific hybridization, which is also known under the name of allele-specific oligonucleotide (ASO) hybridization. In this method, two short oligonucleotide probes are used, which differ by only one nucleotide. The studied DNA is hybridized separately with these two labeled probes. The genomic DNA will hybridize only to the probe that has the perfectly complementary sequence. The allele-specific PCR technique can be performed using a double-stranded DNA marker whose signal strength allows the quantification of DNA amplification. SYBR Green's analysis of a mutation has the considerable advantage of simplicity and speed.
[0236] [0236] However, the simple analysis by SYBR Green generates, particularly for the identification of point mutations, a specific non-negligible detection that makes this approach not very reliable when the objective is a clinical or industrial kit. Several other methods have been developed to circumvent this non-specificity effect, but they consist of two or more stages methods, making them more time consuming.
[0237] [0237] Consequently, we have designed and developed an analytical method that leads to a qualitative conclusion on the presence or absence of a genetic polymorphism. The determination of the positivity of the mutational state of a gene will be established by calculating the percentage of cirDNA mutated in relation to the non-mutated cirDNA. For each mutation, it will be possible to determine the percentage of "non-specificity", called "threshold", above which it will be established unambiguously that the gene contains a polymorphism.
[0238] [0238] However, the use of an amplification called "reference" can be dangerous for the analysis of cirDNA, as our results demonstrated that the quantification of amplified DNA in this case varies very significantly depending on the length of the amplified fragment (the amplicon So, keeping in mind our results, in the IntPlex method we will compare the amplification of an amplicon less than 100 bp, which contains the mutation to be detected, and the amplification of an amplicon of identical size.
[0239] [0239] In order to limit as much as possible the potential disparity in the sequences included in the cirDNA, the control amplicon will be located close to the amplified sequence. Quantification of the reference amplicon will also allow the determination / confirmation of the total specific amount of cirDNA.
[0240] [0240] Since mononucleosomes have a size ranging from 180 to 220 bp, the ratio between the amount of an amplicon greater than 220 bp and the amount of an amplicon less than 180 bp, conventionally corresponds to a degree of integrity or of apoptosis. We designed the IntPlex so that the ends of the mutated and control amplicons are separated by a minimum distance of 220 bp.
[0241] [0241] The integrity index (amplification of a long fragment / amplification of a short fragment) can be further optimized to generally discriminate healthy individuals from individuals with a pathology (for example, cancer), by decreasing the size of the fragment long for a size> than the short fragment, and> 180 bp.
[0242] [0242] Figure 9 shows an example of using the IntPlex method for analyzing SNPs. In this example, Primer B1 includes at its 3 'end the base change due to the "wild type" state. Amplification with primers A1 and A2 produces a 60 bp fragment. The mutated fragment is amplified by primers B1 and B2 Amplification using primers A1 and B2 will produce a 300 bp fragment.
[0243] -A detecção qualitativa da presença de um polimorfismo genético (por exemplo, SNP ou mutação); -A quantificação específica de cirDNA; -A avaliação da taxa de apoptose; Pelos seguintes cálculos no esquema da Figura 9: -A detecção qualitativa da presença de um polimorfismo genético (por exemplo, SNP ou mutação); -% B1B2/A1A2 maior do que um limiar específico; -com B1B2 definido como a sequência que contém a polimorfismo genético (por exemplo, SNP ou mutação). [0243] Consequently, the invention consists of a method for the analysis of cfDNA that will integrate, based on the scheme shown as an example: -The qualitative detection of the presence of a genetic polymorphism (for example, SNP or mutation); -The specific quantification of cirDNA; -The assessment of the rate of apoptosis; By the following calculations in the scheme in Figure 9: -The qualitative detection of the presence of a genetic polymorphism (for example, SNP or mutation); -% B1B2 / A1A2 greater than a specific threshold; -with B1B2 defined as the sequence containing the genetic polymorphism (for example, SNP or mutation).
[0244] [0244] The specific quantification of the total cirDNA: quantity. A1A2.
[0245] [0245] The specific quantification of the total cirDNA: quantity B1B2.
[0246] [0246] The assessment of apoptosis rate by determining cirDNA fragmentation in terms of%: B1B2 or A1A2 / A1B2.
[0247] [0247] If we model the integrated system considering that X and Y is the distance in DNA between the 5 'ends of the primers, the integrated IntPlex system can be modeled as follows: (A1A2) = (B1B2) = X (A1B2) = Y with X <180 and Y> X, Ideally: 50 <X <100 and 200 <Y <350.
[0248] [0248] This method of identifying the presence or absence of a genetic mutation is very convenient since it is very fast and not very expensive. In addition, it allows dispensing with sophisticated techniques such as sequencing. On the other hand, sequencing leads to an answer without possible doubts (but due to contamination or maintenance errors).
[0249] [0249] CirDNA consists of tumor DNA and non-tumor origin. Very little is known about the respective contribution of these two types of cirDNA during tumor progression. IntPlex should allow you to move forward on this issue and that information will bring valuable diagnostic and / or prognostic benefits. In fact, the amount of mutated DNA, and therefore tumor DNA, can be linked by this method directly to the amount of non-tumor DNA. The calculation of this percentage can be correlated both with the total amount of cirDNA released and with the progression or regression of the tumor. EXAMPLE 4 CONTRIBUTION OF THE COMBINATION “CHANGE IDENTIFICATION / QUANTIFICATION / INTEGRITY INDEX” FOR THE DIAGNOSIS OF THE CANCER
[0250] [0250] These three diagnostic parameters can be studied separately, but a more sensitive multiplexed analysis (in particular with the aid of bioinformatics software) will increase its diagnostic value for monitoring cancer patients and the teragnosis value of these for choosing individualized therapy (Figure 10).
[0251] [0251] The contribution of these three factors can be modeled using an algorithm that will allow assessing the risk incurred for each individual cancer patient.
[0252] [0252] As a simple example, we can calculate a diagnostic factor like = ([Mi + 1) x (Q + A).
[0253] [0253] Where M, Q and A are risk factors determined by detecting a mutation, quantifying tumor cirDNA and assessing the apoptotic index, respectively. EXAMPLE 5 EXAMPLES OF APPLICATION OF INTPLEX TECHNOLOGY 1) DETECTION OF KRAS MUTATIONS IN HUMAN BLOOD SAMPLES IN THE CANCER DIAGNOSTIC CONTEXT
[0254] [0254] The RAS gene (KRAS and NRAS) is subject to somatic mutations in more than 50% of colon tumors, and in about 50% of adenomas larger than 1 cm in diameter. On the other hand, it is very rarely mutated in small adenomas (less than 10%). The mutations, usually SNPs, have no implications for HRAS, but affect KRAS codons 12 and 13 and NRAS 12, 13 and 61. The exact role of these mutations is not known. They can transform a small adenoma into a large dysplastic adenoma, or they can be present from the beginning in very proliferative cells. KRAS mutations are present in 30 to 40% of colorectal tumors.
[0255] [0255] Thus, there is a strong need for a simple and rapid assay to detect SNP n KRAS-type mutations in order to individually guide patients with CRC towards targeted anti-EGFR therapy (6). In fact, the activity of potent EGFR-specific inhibitors is blocked when tumor cells carry a mutated KRAS gene. During the ASCO annual meeting in 2008, a general consensus was reached arguing that all patients eligible for EGFR-targeted therapies should first be tested for the presence of KRAS mutations prior to the initiation of first-line therapy (6).
[0256] [0256] The sequencing of DNA obtained from tumor sections currently represents the "gold standard" for the identification of SNPs. This method is carried out after excision, requires the presence of an anatomopathology laboratory and an analysis laboratory, and is a time-consuming and expensive method. cirDNA could be a non-invasive tool with great diagnostic power if a specific method of analysis can allow the quantification and detection of mutations in a simple and rigorous way, particularly of SNPs in KRAS in the teragnotic context of anti-EGFR treatments.
[0257] [0257] In this way, we have adapted the IntPlex methodology for the more specific detection of SNPs in KRAS, in the context of the teragnotic treatment directed at CRC. This would respond to the urgent clinical need for the use of potent EGFR-specific inhibitors and the mutational state of KRAS.
[0258] [0258] In this system the mutation is located at the 3 'end, which leads to two possible models: the conventional IntPlex and the reverse IntPlex. As previously described, the IntPlex system includes two pairs of primers (Figure 9) that amplify DNA fragments of a size less than 100 bp. This amplification gives fragments that are 300 bp apart from one end to the other. This drawing includes a pair of primers for amplifying the "wild type" sequence that constitutes the reference or standard amplification (A1A2) and another pair of primers for amplifying the mutated sequence (B1B2) (Figure 4). use of the "reference" amplicon with exactly the same size and with a sequence close to the other, the percentage of DNA mutated by the ratio calculation: (A1G12Vrev16 / B1B2) and (G12Vconv19 / A1A2; in the figures the names of the primers are different ) (see Figure 11 and A), for example, for the "reverse" KRAS (Krev) and "conventional" KRAS (Kconv) systems, respectively. Our previous results demonstrate the enormous importance of the size of the amplified fragments generated by Q-PCR using a cirDNA sample. In addition, the Q-PCR analysis of fragments obtained with A1B2 primers (size = 300 bp) allowed us to determine the integrity index (DNA Integrity Index (DII)) (ratio between the long and short fragments). The DII indicates the fragmentation status of cirDNA. The integrity index corresponds to the inverse of the apoptosis rate (also known as the ctDNA fragmentation index). a) Design of IntPlex Q-PCR systems
[0259] [0259] The conventional IntPlex (Figure 11 A) uses the G12V primer normally used in the literature for the detection of the K12 G12V mutation and this primer is a sense oligonucleotide with the mutation located at the 3 'end of this gene. The reverse IntPlex (Figure 11B) uses the antisense primer with the mutation at the 3 'end. All primers of these two systems were selected by the software (Material and Methods). The IntPlex Kconv and Krev systems were applied to detect the G12V mutation in KRAS. Primers that specifically detect this mutation were designed to cover the mutated area of the KRAS gene (Figures 11 A - 11 B).
[0260] [0260] The primer sense is conventionally defined as containing a sequence included in the DNA coding strand. The conventional and reverse IntPlex systems are differentiated by the sense or antisense orientation of the primer directed to the mutation. b) Illustration of the importance of the size parameter for the quantification of cirDNA.
[0261] [0261] In this experiment, two IntPlex Krev and Kconv systems were tested using cirDNA isolated from plasma samples from xenografted mice. Sequences of chemically modified oligonucleotide primers and blocking oligonucleotides developed specifically for the IntPlex system to demonstrate their effectiveness and sensitivity, or the detection of the presence of the G12V KRAS or V600E BRAF mutations are shown in Table 2. In this example, AS or Q- PCR using the blocker method (ASB Q-PCR). BRAF and KRAS mutations were detected using the “conventional” and “Inverse” IntPlex systems.
[0262] [0262] Our results gave identical profiles with Krev and Kconv (Figures 12 and 13).
[0263] [0263] Figures 12 and 13 clearly show that determining the concentration of cirDNA is equivalent when the amplicon is the same size, regardless of the target sequences. In addition, the results indicate that the value obtained for the 67 bp amplicons (A1A2 and B1B2) is 2.2 times greater and 1.4 times greater than the value obtained for the 189 bp amplicon (KrasH2) and 7, 9 times and 9.0 times higher when compared to the values for the 312 and 320 bp amplicons (A1B2) of Kconv and Krev, respectively. Thus, the cross analysis of these results confirms the accuracy of the quantification of cirDNA by Q-PCR with the primer systems that generate amplified fragments with identical sizes, and, consequently, validates the two Krev and Kconv analysis systems.
[0264] [0264] The integrity index (inversely due to the rate of apoptosis) corresponds to the ratio between the concentration of short DNA fragments (less than 180 bp) and the concentration of long DNA fragments (greater than 220 bp), or that is, A1B2 / B1B2 for Krev and A1B2 / A1A2 for Kconv. The rate of apoptosis allows an estimate of the percentage of DNA of apoptotic origin and originating from necrosis and, thus, determines the origin of cirDNA. With the Krev system we obtained an apoptosis rate of 0.78 for the genomic DNA of the placenta (a DNA that is not released and is not mutated), and 2.00 for the mutated DNA from cultures of CRC cells; SW620. With the Kconv system we obtained a rate of 1.28 for DNA from the placenta and 1.92 for DNA from SW620 cells (Table 3).
[0265] [0265] We also calculated the apoptosis rate (equivalent to the inverse integrity index) of cirDNA isolated from plasma samples from xenografted mice (with SW620 cells that produce tumors), using both systems, Krev and Kconv. With Krev the rate of apoptosis obtained was 8.33 and with Kconv it was 8.34. The rate of apoptosis of cirDNA is higher (about 8 and 4 times) than that of genomic DNA (placental DNA and SW620 cell DNA, respectively). The rate of apoptosis can be different when comparing the DNA rates of the placenta and cells as they are of different origins, tissue (placenta) and cells, therefore, are different sampling methods.
[0266] [0266] Surprisingly, the rates of apoptosis for the same sample are very similar with the two systems, Krev and Kconv, highlighting the robustness of this measurement. In addition to the direct comparison between the amplification of two sequences of identical size, this robustness comes from the extreme proximity of such sequences. Despite the same size, a "reference" sequence that is distant from the mutated sequence (for example, located on another chromosome) would not allow a similar level of accuracy. 2) Detection of BRAF mutations in blood samples
[0267] [0267] The BRAF gene is subject to somatic mutations in more than 14% of CRC tumors. The V600E mutation represents more than 90% of the mutations in BRAF. As with KRAS mutations, BRAF mutations render treatment with anti-EGFR ineffective. The assessment of the presence (or not) of this mutation is therefore necessary at the time (or more precisely before) of the treatment of a patient with metastatic CRC. Consequently, we designed and developed a conventional IntPlex system (mutation at the 3 'end of primer B1) for the detection of BRAF mutations in cirDNA (Figure 14).
[0268] [0268] Plasma samples from a xenograft mouse with human HT29 CRC cells that have the BRAF V600E mutation in their genome were analyzed with this IntPlex system (Figure 15).
[0269] [0269] The average concentration of the short reference amplicon (A1A2) was 31.5 ng / ml and therefore was about 8 times higher than the concentration of the long amplicon (4.2 ng / ml) in cirDNA from sample S4 HT29 (figure 14). Likewise, the concentration of the fragment obtained with the human primer pair WT BRAF was 15 ng / ml and was about 2 times lower than the concentration of the short BRAF amplicon. These results clearly confirm that aiming at a short DNA sequence (<100 bp) produces a more important amplification of cirDNA extracts than if we target larger sequences (149 and 288 bp). The percentage of human DNA mutated due to the reference WT sequence (A1A2) was 77.5%. Theoretically it should have been 50% when considering the heterozygosity of the BRAF mutation in this HT29 cell line (only one of the two alleles of the chromosome pair has the mutation). In order to assess the sensitivity of the IntPlex system, the S4 sample of DNA from the plasma of xenografted mice was diluted 1/10 in a sample of genomic DNA from the placenta (Figure 15). The results summarized in Figure 15 indicate that the mutated DNA corresponds to 6.95% of the non-mutated DNA and this is approximately 10 times smaller than that obtained with the undiluted sample S4. The amplification of the long-length sequence is slightly less, but significantly, than that of the reference sequence (82.5%).
[0270] [0270] The results (presented as percentages of the concentrations obtained by amplifying the reference sequence A1A2) from these two experiments show the importance of accurately taking into account the size of the amplified fragments and the validity of the IntPlex system (Figures 15 and 16) . In fact, the calculation of the percentage of mutated cirDNA can be dramatically different depending on the amplification system used as a reference: 77.5% when using a reference of the same size (101 bp) and 56.7% when using a reference 288 bp. The discovery that when cirDNA is diluted in genomic DNA (1/10) the percentage of cirDNA is 6.95% with the reference of the same size, and 8.45% with reference to the size of 288 bp, shows that the size parameter is less important when cirDNA is diluted in genomic DNA.
[0271] [0271] The rate of apoptosis varies considerably depending on the amount of cirDNA because it corresponds to 7.41 in the case of undiluted cirDNA and 1.21 in the case of diluted cirDNA (that is, more than 6 times higher). This difference is important in many ways, and is characteristic of cirDNAs. 3) DESCRIPTION OF THE USE OF THE INTPLEX METHOD FOR CIRDNA ANALYSIS IN HUMAN PLASMA SAMPLES
[0272] [0272] KRAS SNP mutations (G12V, G12D, G12C, G13D and G12A) and BRAF's V600E mutation are the causes of approximately 82% of sporadic cases of mutated CRCs (ie 75% of all CRCs). These mutations are present in 94% of patients, whose KRAS and BRAF mutations are associated with CRC and who do not respond to anti-EGFR therapies (about 50% of all CRC cases).
[0273] [0273] We adapted IntPlex technology to detect these mutations in cirDNA extracts. The sequences of the oligonucleotide primers and the chemically modified blocking oligonucleotides specifically developed for the IntPlex system to detect the presence of the aforementioned mutations are shown in Table 4. In this example, AS Q-PCR was used using the blocking method (ASB Q-PCR). The BRAF mutation and the 6 KRAS mutations were detected using the “conventional” and “Inverse” IntPlex ASB Q-PCR systems, respectively.
[0274] [0274] As an example, Figure 17 shows the results obtained with plasma samples from a patient with CRC who apparently carries the G12V KRAS mutation (CRC1), a patient with CRC who apparently does not have this mutation (CRC2) and a healthy individual (HHP1).
[0275] [0275] In CRC1, 68% of the cirDNA fragments carry the G12V KRAS mutation, while the percentage for the other KRAS mutations does not reach 1.2% for this patient.
[0276] [0276] In CRC2, 0 to 6.6% of cirDNA fragments appear to carry BRAF or KRAS mutations.
[0277] [0277] In HHP1, 0 to 3.2% of the cirDNA fragments appear to carry BRAF or KRAS mutations.
[0278] [0278] CRC2 data shows a significant% of apparently mutated cirDNA but the level appears the same for the 4 mutations. Given the fact that, with the exception of very rare cases, these mutations are mutually exclusive, the% cirDNA threshold mutated to specifically define the mutational state is not reached in the case of CRC2. Thus, the values obtained for the quantification of mutated cirDNA in the CRC2 plasma correspond to a non-specific effect. The positivity threshold can be set here at least 7%, but a study using a significant number of samples is necessary in order to determine this threshold for each mutation. In addition, an algorithm can be used to integrate the threshold within a sample in order to estimate the discrimination of the percentage of a mutation in relation to the percentage of others. However, this figure shows that only CRC1 carries a mutation (G12V).
[0279] [0279] Surprisingly, these and other results in several clinical samples (not shown) indicate that the proportion of mutated cirDNA fragments appears to be extremely high (between 17% and 70%) when compared to the results described in the literature (on average 1 % and never more than 10%) (5, 7). This illustrates the ability of our method to produce a sensitive and specific analysis of tumor cirDNA and its innovative character.
[0280] [0280] As a consequence the CRC1 patient in contrast to the CRC2 patient unfortunately cannot be treated with an EGFR inhibitor.
[0281] [0281] Thus, this adapted IntPlex method, which is part of the present invention, appears to be a simple method for the analysis of cirDNAs based on accurate knowledge of the size of its population. It depends on an accurate choice of oligonucleotide primers, which allow direct analysis in a single Q-PCR step. Three independent data sets from the analysis of circulating nucleic acids (NA) (1. Detection of mutation (s), 2. Exact quantification of the tumor and total cirDNA concentration and 3. Estimation of a ratio due to the apoptotic origin of the cirDNA) can be integrated into the same test. EXAMPLE 6 CIRDNA CONCENTRATION PROFILES FOR HHP AND CRC SUBJECTS
[0282] [0282] CirDNA concentrations were determined from plasma samples from three patients with CRC and three healthy subjects by Q-PCR using primer sets that amplify a fragment of 60, 73, 101, 145, 185, 249, 300, 357, 409 bp, as previously described. The concentration profiles obtained are specific both for subjects with CRC and for all healthy subjects. The maximum mean value was 6.19 and 943.59 ng / ml in plasma for HHP and CRC subjects, respectively. The greatest discrimination by calculating the ratio of the HHP / CRC integrity index was obtained when using the ratio 300/60 and 300/73 (8.18 and 10.07, respectively), confirming the previous data. The 409/60 ratio is apparently the highest, but it was arbitrarily disregarded since the concentration obtained by amplifying fragment 409 in the CRC plasma was close to the sensitivity threshold of the analysis. By subtracting the concentration obtained by amplifying a fragment size from the following, due to the size increase, the% of the amount of cirDNA within the 60-409 bp range between both successive amplicon sizes can be estimated (given the Cn as the concentration of ctDNA when an amplified fragment of size n is detected, and Cn + 1 the cirDNA concentration when the amplified fragment of larger approximate size is detected in the series of increasing amplified fragment size, the concentration existing between both sizes is calculated such as Cn - Cn + 1).
[0283] [0283] The values expressed in% of ctDNA vs fraction of length of ctDNA (range) are shown in Figure 18 in histograms. The data suggest that CRC and HHP plasmas have the same cirDNA quantity profile, in the 60-73, 73-101 and 101-145 bp ranges, with a notably higher level for CRC plasmas in the 73- 101. In contrast, with the absence of HHP cirDNA from ranges 145-185 to 357-409 bp, the level of cirDNA is significantly detected, decreasing by 9 to 2%. A high proportion (35%) was found for HHP cirDNA larger than 409 bp, in contrast to the very low level determined for CRC cirDNA (2%).
[0284] [0284] Clearly, these data show the high discrimination between HHP and CRC plasmas, a result that was not expected for the technicians of the subject at the moment. EXAMPLE 7 PARAMETERS FOR THE LOGISTIC FUNCTION PROPOSED IN A METHOD FOR THE DIAGNOSIS OR THE PROGNOSIS OF A PATHOLOGICAL OR PHYSIOLOGICAL STATE, SUCH AS THE PRESENCE OF A TUMOR OR THE PROGRESSION OF A TUMOR IN A PATIENT, WHICH IS A SEASONAL OR POSSIBILITY. SNP (IE, THE PRESENCE OF A MUTATION ASSOCIATED WITH A CANCER)
[0285] [0285] Values that can be combined using a logistic function, including at least two biomarkers in order to obtain a final value that is relevant from a diagnostic or prognostic point of view.
[0286] [0286] (See Figure 9).
[0287] [0287] (A1A2) = (B1B2) = X (A1B2) = Y with X <180 and Y> X, Ideally: 50 <X <100 and 200 <Y <350
[0288] - B1B2 é definido como a sequência que contém a polimorfismo genético (por exemplo, SNP ou mutação). - A1A2 é definido como a sequência que não contém um polimorfismo genético (por exemplo, SNP ou mutação) e está localizada sobre a mesma fita de DNA; - Os números correspondem ao número de nucleotídeos da sequência amplificada (amplicon); - X e Y são as distâncias no DNA genômico entre as extremidades 5' dos primers utilizados para amplificar o amplicon curto e longo, respectivamente. [0288] Where: - B1B2 is defined as the sequence that contains the genetic polymorphism (for example, SNP or mutation). - A1A2 is defined as the sequence that does not contain a genetic polymorphism (for example, SNP or mutation) and is located on the same DNA strand; - The numbers correspond to the number of nucleotides in the amplified sequence (amplicon); - X and Y are the distances in the genomic DNA between the 5 'ends of the primers used to amplify the short and long amplicon, respectively.
[0289] [0289] These biomarkers allow: 1. The qualitative detection of the presence of a genetic polymorphism (for example, SNP or mutation) by determining the% B1B2 / A1A2 at a level higher than a specific threshold, or for each set of primers of genetic polymorphisms.
[0290] 2. A quantificação específica de cirDNA total e tumoral: quantidade de A1A2 e B1B2, respectivamente. 3. A avaliação do índice de fragmentação do DNA (na presente invenção, as expressões "taxa de apoptose”, "índice de fragmentação do DNA” e "índice de integridade” têm o mesmo significado):% B1B2 ou A1A2/A1B2. [0290] Being B1B2 defined as the sequence containing the genetic polymorphism (for example, SNP or mutation). 2. The specific quantification of total and tumor cirDNA: amount of A1A2 and B1B2, respectively. 3. The evaluation of the DNA fragmentation index (in the present invention, the expressions "rate of apoptosis", "DNA fragmentation index" and "integrity index" have the same meaning):% B1B2 or A1A2 / A1B2.
[0291] [0291] Being applicable to all circulating nucleic acids (DNA, RNA, siRNA, miRNA ...). - The use of nucleic acid of specific length, for example, <180 bp and ideally <100 bp, as a nucleic acid standard for the calibration of Q-PCR. EXAMPLE 8 DEMONSTRATION THAT CTDNAS OF LOWER SIZES TO 100 PB ARE OF SIGNIFICANT PROPORTIONS AND THAT THE PREVIOUSLY ESTABLISHED HYPOTHESIS BASED ON THE ANALYSIS BY ELECTROPHORESIS IS CORRECT
[0292] [0292] Agarose gel electrophoresis of 20 μg ctDNA extracted from two patients with CRC (CRC021 and CRC019). The size standard (ladder) was made with several 100 pd DNA fragments. Portions of the gel were removed immediately after the end of the run. For CRC021 a portion of the gel corresponding to 10-440 bp was removed and subjected to Q-PCR. For CRC021 a portion of the gel corresponding to 30-130 and 130-500 bp was removed and subjected to Q-PCR. The conditions of Q-PCR were as previously described for the quantification of ctDNA; detecting the 73 bp, 145 bp and 300 bp amplicons of the KRAS intron, as previously described.
[0293] [0293] In the CRC021 plasma, 47% of total ctDNA was found between 73 and 145 bp, while 36% and 17% were found in the ranges of 145-300 and> 300 bp, respectively. In CRC019 plasma, 61% of total ctDNA was found between 73 and 145 bp, while 35% and 5% were found in the ranges of 145-300 and> 300 bp, respectively. In the portion of the gel between 30 and 130 bp of 57% of total ctDNA were detected (see figures 19A and 19B).
[0294] [0294] These data prove that ctDNA of size less than 180 bp and, particularly, less than 100 bp exists in significant quantities. Thus, electrophoresis is not an appropriate method of analysis to assess the size of ctDNAs. This is the first demonstration that the previously established hypothesis based on electrophoresis analysis demonstrating that apparently ctDNAs are larger than 180 bp is not correct.
[0295] 1. fragmentos de ctDNA abaixo de 180 pb podem variar de um nucleotídeo para outro levando a baixa concentração naquele tamanho preciso; 2. o corante fluorescente, tal como o verde Sybre, têm um nível máximo de intercalação (ou seja, uma molécula de verde Sybre a cada 23 nucleotídeos) que limita drasticamente a intensidade do sinal no ctDNA de tamanho reduzido. Por exemplo, um fragmento de DNA de 69 pb tem 3 vezes menos sinal do que um de 207 pb. [0295] We postulate the hypothesis that ctDNA fragments smaller than 180 bp in size are not visible after electrophoresis and fluorescent dye staining, as they are below the signal threshold due to: 1. ctDNA fragments below 180 bp can vary from one nucleotide to another leading to low concentration at that precise size; 2. the fluorescent dye, like Sybre green, has a maximum level of intercalation (that is, one molecule of Sybre green per 23 nucleotides) which dramatically limits the signal strength in the reduced size ctDNA. For example, a 69 bp DNA fragment has 3 times less signal than a 207 bp fragment.
[0296] [0296] Comparison of DII values (Table 5) from genomic DNA, and ctDNA from mice plasma (xenografted and non-xenografted) and (see figure 20) from human plasmas (healthy and with CRC). The DII was estimated by the ratio between the concentration obtained that aimed at a sequence of 300 bp and a sequence of 60 bp in the KRAS region. The mean value of the HHP DII (n = 16) is significantly different from the mean value of the CRC DII (n = 12) (mean of 0.565 and 0.122, respectively, p <0.001). A similar difference was observed in the animal model where the mean DII is 0.447 for the healthy plasma ctDNA (n = 9), 0.645 for non-tumor derived ctDNA (n = 9); and 0.027 for tumor-derived ctDNA (n = 9).
[0297] [0297] This supports the discovery of the detection of amplicons of sizes less than 100 bp, in particular 60 bp, as used here for the determination of an IBD.
[0298] [0298] There are two configurations on the design of the primers used in the multiplex method according to the invention: conv and inv. We determined the DII from the plasma of a patient with CRC using the conv and inv configuration in the KRAS and BRAF region (containing the mutation in the 2nd exon and V600E hot spots, respectively), the conv configuration in the 2nd intron of the KRAS gene (BRAF conv). We compared these DII with those calculated in the distant region within the same gene (KRASconv long / KRASint short, representing the ratio between the concentration obtained with the use of the primer pair that leads to amplification of the long sequence as used in the KRAS conv; with the concentration obtained with the use of the primer pair that leads to amplification of the short sequence as used in KRAS int) and with that calculated in the distant region of two different genes (KRAS long conv / BRAF inv short, representing the ratio between the concentration obtained with the use of the primer pair that leads to the amplification of the long sequence as used in the KRAS conv and the concentration obtained with the use of the primer pair that leads to the amplification of the short sequence, as used in BRAF inv).
[0299] [0299] First, the data clearly demonstrates the high precision and low variability of the DII value calculated in our invention whatever the region of the gene used, due to the DII value varying from 0.077 to 0.094 (correlation coefficient = 9.1% ) (see figure 21).
[0300] [0300] Second, the values obtained using primer pairs that target distant DNA sequences, both within the same gene and in different genes, are different and more precisely significantly lower (0.061 and 0.048, respectively), than those found using the designed primers of the present invention.
[0301] [0301] The maximum value coefficient from the Q-PCR analysis and DNA extraction, under the experimental conditions described above, is 23% (n = 12). EXAMPLE 11 DETERMINATION OF VARIOUS INDEXES INVOLVING THE QUANTITY OF CTDNA WITH THE FRACTION SIZE LESS THAN 100 PB
[0302] [0302] Several indices were determined from the data presented in Figure 18. These indices were calculated from different fractions of size (see Table 6).
[0303] [0303] The data clearly shows that determining the concentration of the ctDNA fraction below 100 bp is of great interest and makes it possible in large part to discriminate between the plasma of healthy individuals and patients with CRC. Second, the use of the ctDNA size fraction ratio, such as SFR, contributes greatly to this goal. EXAMPLE 12 DETERMINATION OF SEVERAL PARAMETERS, AS SUCH AS SFR, INDICATIVES OF THE CTDNA FRAGMENT SIZE STANDARD
[0304] [0304] We studied the size pattern of the mutated ctDNA compared to the size pattern of unmuted ctDNA. To achieve this goal, a set of primers was used, amplifying the target size within the same region. This set generates the amplification of sequences in the hot spot region of the KRAS gene (12th and 13th exon 2 codons), where the direct primer for each pair of primers is designed specifically for a point mutation in this region, or for the sequence wild type (see Table 7 below and Figures 22A-22E). These sets were carefully selected to promote high sensitivity and high specificity, whether for the quantification of mutated or non-mutated target sequences (see Table 8 below).
[0305] [0305] The primers used to carry out this experiment are as follows: (see Table 8):
[0306] [0306] Next, the% mutated ctDNA was determined by determining the concentration using a set of primers that amplified the shortest target (82 bp) from the total ctDNA concentration (the sum of the concentration of the mutated ctDNA being not mutated).
[0307] [0307] The determination of several parameters indicative of the size pattern of the ctDNA fragment, a database, are presented in the table (Table 7) or plotted in histograms (see Figures 22A-22E). Size fraction is expressed in% for the highest value obtained in each set. The proportion of ctDNA fragments <138 bp or 145 bp was determined by subtracting the concentration determined using the primer set that amplifies the 82 bp target by the concentration determined using the primer set that amplifies the 138 bp target. When the value is negative, the data are arbitrarily expressed as 0. The proportion of ctDNA fragments> 300 bp was determined using the primer set that amplifies the target of 300 bp. The ctDNA integrity index (DII) was determined by calculating the concentration ratio determined using the primer set that amplifies the 300 bp target and the concentration determined using the primer set that amplifies the 82 bp target. The proportion of the size fraction (SFR) was determined by calculating the ratio between the concentration of fragments <138 or 145 bp, and the concentration of fragments between 138-145 bp and 300 bp. Number under the histograms: 4,5,6,14, plasmas from CRC patients with KRAS positive mutational status (CRC4-6 and CRC 14). H, healthy individuals (n = 9).
[0308] [0308] The proportion of different fractions of ctDNA sizes, the integrity index and a proportion of the fraction of size (called SFR) of human plasmas from healthy individuals and four CRC patients with a point mutation in KRAS are summarized in the figure. Mutant ctDNAs are mostly composed of fragments <138 bp, while non-mutant ctDNAs are mostly made up of fragments in the size range of 138-300 bp and very few fragments <138 bp. Alternatively, the ctDNA of healthy individuals appears to be clearly made up of fragments <138 bp and> 300 bp, with no apparent fragment between 138 and 300 bp.
[0309] [0309] The data clearly shows that analysis of the size fraction of the ctDNA, especially by determining the proportion of the size fraction, such as the SFR, which was calculated in this study can assist in distinguishing ctDNAs with mutated versus non-mutated KRAS. In addition, analysis of the size fraction could reveal an indication of the nature of the ctDNA release mechanism. However, the data suggest that non-tumor-derived ctDNA in the CRC patient may originate mainly from apoptosis in contrast to healthy individuals' ctDNA, and to a lesser extent from the tumor-derived ctDNA. The calculation of such indices should facilitate the analysis of the size pattern since the amplification experiments using the serial nested Q-PCR, as performed at present, are time consuming. EXAMPLE 13 COMPARISON OF DETERMINING THE% OF MUTATED FRAGMENTS FROM THE TOTAL CTDNA BY USING THE LENGTH OF AMPLICON
[0310] [0310] ctDNA quantification was determined by amplifying target sequences of increasingly larger sizes of 82, 138, 300 bp (see Table 9) from the plasma of patients with tumor cells that carried the G12D KRAS, G12D KRAS mutations and G13D KRAS in CRC40, CRC50 and CRC60, respectively. The quantification of mutated ctDNA was performed with the primer pairs consisting of the same reverse primer containing the target mutation in the 3 'strand and with the primers from a distant region of 82, 138 and 300 bp from both 5' ends. The non-mutated ctDNA was quantified using the same forward (reverse) primers and the same reverse primers (reverse) with the wild type sequence (data from the previous example). The total ctDNA corresponds to the sum of the mutated and non-mutated fragments.
[0311] [0311] Clearly the data shows that the determination of the% mutant ctDNA fragments varies according to the size of the detected amplicon, and demonstrates that the quantification of mutant ctDNA fragments is much higher when the sizes of the amplicons is less than 100 bp. This leads to a more accurate detection of the presence of a mutation in the ctDNA by determining the percentage of mutant fragments; positive detection is determined when this value is greater than the percentage of a threshold. There is, for each CRC plasma, an increase of about 2.5, 3.4 and 6.3 times the mutated% when an 82 bp amplicon is detected, compared to the detection of a 138 bp amplicon, whereas the proportion of% ctDNA on which the value is calculated was 3.3, 3.9 and 9.3 times higher in CRC4, CRC5 and CRC6, respectively (see Table 9).
[0312] [0312] We determined the DII with PCR amplification of several short and long sequences from the animal experiment (see Table 11 below and the Examples above) and the ctDNA size profile of clinical samples (see Table 12 below and the Examples above).
[0313] [0313] If we consider that the concentration determined by detecting the short amplicon such as 60 bp corresponds to the concentration of total ctDNA, the DII corresponds to% of the fraction of the ctDNA larger than the long amplicon.
[0314] [0314] The data show that the largest difference between plasmas from healthy and CRC patients were observed in calculating the DII with detection of amplicons with sizes <100 bp, such as 60 or 73 bp, and amplicons with sizes> 249 bp. The DII calculated from the mouse experiment confirms this observation.
[0315] [0315] When comparing, more precisely, the DII that is calculated using Q-PCR detection of the amplicon larger than 100 bp, such as 101 or 145 bp, with the DII calculated using amplicons with sizes of 60 or 73 bp , the first is about 1.5 times lower in clinical samples, and about 17 times lower in samples from xenografted mice. Thus, the use of detection of amplicons of sizes smaller than 100 bp and, in particular, smaller than 73 bp, allows for greater discrimination between healthy individuals and patients with CRC.
[0316] [0316] It should be noted that the use of the fraction> 409 bp showed greater discrimination between healthy individuals and patients with CRC and that the use of the fraction> 300 bp. EXAMPLE 16 DESCRIPTION OF THE DNA REGIONS LOCATED DOWNWARD OR THE AMOUNT OF A MUTATION USING THE METHOD ACCORDING TO THE PRESENT INVENTION TO DETECT A MUTATION (PARTICULARLY BY SUCH INTPLEX METHOD)
[0317] • tamanho mínimo do primer = 15 nucleotídeos; • tamanho máximo do primer = 30 nucleotídeos; • espaçamento entre dois primers (entre as extremidades 3' de ambos os primers) = 5 pb; • faixa de tamanho do amplicon para A1A2 ou B1B2 = 35 a 100 pb; • estando o A1B2 na faixa de tamanho de 250-450 pb. [0317] Several reports have described methods that target the region located downstream or upstream of a mutation when proposing the detection of such a mutation. For example, several primers (from 18 to 30 nucleotides) were designed to hybridize with the DNA sequence corresponding to that region. At present, we claim to protect the use of molecular entities that target other regions according to the description of the design of the primers used for this method (Figure 11) in both the conv and rev configurations. (respectively, conventional and inverse (inv) configuration, also called conv and rev (or inv) designed for molecular entities associated, respectively, with these conv and inv. configurations). We can describe such regions from the mutation to be detected taking into account the following parameters: • minimum primer size = 15 nucleotides; • maximum size of the primer = 30 nucleotides; • spacing between two primers (between the 3 'ends of both primers) = 5 bp; • amplicon size range for A1A2 or B1B2 = 35 to 100 bp; • A1B2 being in the 250-450 bp size range.
[0318] • a região onde o primer B2 deve hibridizar, e que está localizada de 5 a 85 nucleotídeos a jusante da posição onde se encontra a mutação na fita de DNA non sense. • a região onde o par de primers A1A2 pode ser desenhado dentro dos 430-100 nucleotídeos a montante a partir da posição da mutação a ser detectada. [0318] In the case of the conv design, as shown in figure 11A, the molecular entities to be protected are those that target: • the region where primer B2 should hybridize, and which is located from 5 to 85 nucleotides downstream from the position where the mutation is found in the non-sense DNA strand. • the region where the A1A2 primer pair can be drawn within the 430-100 nucleotides upstream from the position of the mutation to be detected.
[0319] • a região onde o primer A1 deve hibridizar, e que está localizada de 5 a 85 nucleotídeos a montante da posição onde se encontra a mutação na fita de mutação na fita de DNA non sense. • a região onde o par de primers B1B2 pode ser desenhado dentro dos 100-430 nucleotídeos a jusante a partir da posição da mutação a ser detectada. A) Exemplo da região do DNA a ser utilizada como alvo por nosso método QUANDO A MUTAÇÃO PONTUAL V600E NO BRAF É DE INTERESSEa) Vide a Figura 23 que mostra as regiões onde as entidades moleculares, tal como primers, podem ser direcionadas em nosso método multiplex aplicado a esta mutação.[0319] In the case of the inv design, as shown in figure 11B, the molecular entities to be protected are those that target: • the region where primer A1 should hybridize, and which is located 5 to 85 nucleotides upstream from the position where the mutation is found in the mutation strand in the non-sense DNA strand. • the region where the primer pair B1B2 can be drawn within the 100-430 nucleotides downstream from the position of the mutation to be detected. A) Example of the DNA region to be used as a target by our method WHEN SPECIAL MUTATION V600E IN BRAF IS OF INTEREST a) See Figure 23 which shows the regions where molecular entities, such as primers, can be targeted in our multiplex method applied to this mutation.
[0320] b) Oligonucleotídeos selecionados para os primers B2 para BRAF no sistema convencional (vide a Tabela 13)
[0321] a) Vide as Figuras 24A-24E que exibem as regiões e os primers onde as entidades moleculares, tal como primers, podem ser direcionadas em nosso método multiplex aplicado a esta mutação. [0321] c) Oligonucleotide primers selected for A1 for BRAF in the reverse (inverse) system (see Table 14);
[0322] [0322] KRAS region in the 2nd exon
[0323] [0323] No: KRAS (ENSG00000133703) from the Ensembl database; v-Ki-ras2 Kirsten rat viral sarcoma oncogene homolog [Source: HGNC Symbol; Acc: 6407] Point mutation; 6151
[0324] b) Oligonucleotídeos de DNA selecionados para o par de primers A1A2 para a detecção de mutações KRAS em hot spots no 2° éxon na configuração conv (vide a Tabela 15).
[0325] [0325] 1. Metals, P., and Mandel, P. (1955). Bull Soc Chim Biol (Paris) 37, 999-1007.
[0326] [0326] 2. Stroun, M., Anker, P., Lyautey, J., Lederrey, C, and Maurice, P. A. (1987) Isolation and characterization of DNA from the plasma of cancer patients. Eur J Cancer Clin Oncol 23, 707-12.
[0327] [0327] 3. Anker, P., Mulcahy, H., Chen, X. Q., and Stroun, M. (1999) Detection of circulating tumor DNA in the blood (plasma / serum) of cancer patients. Cancer Metastasis Rev 18, 65-73.
[0328] [0328] 4. Holdenrieder, S., Stieber, P., Chan, L. Y., Geiger, S., Kremer, A., Nagel, D., and Lo, Y. M. (2005); Cell-free DNA in serum and plasma: comparison of ELISA and quantitative PCR. Clin Chem 51, 1544-6.
[0329] [0329] 5. Gormally, E., Hainaut, P., Caboux, E., Airoldi, L., Autrup, H., Malaveille, C, Dunning, A., Garte, S., Matullo, G., Overvad , K., Tjonneland, A., Clavel-Chapelon, F., Boffetta, P., Boeing, H., Trichopoulou, A., Palli, D., Krogh, V., Tumino, R., Panico, S. , Bueno-de-Mesquita, HB, Peeters, PH, Lund, E., Gonzalez, CA, Martinez, C, Dorronsoro, M., Barricarte, A., Tormo, MJ, Quiros, JR, Berglund, G., Hallmans , G., Day, NE, Key, TJ, Veglia, F., Peluso, M., Norat, T., Saracci, R., Kaaks, R., Riboli, E., and Vineis, P. (2004) ; Amount of DNA in plasma and cancer risk: a prospective study. Int J Cancer 111, 746-9.
[0330] [0330] 6. Lievre, A., Bachet, JB, Boige, V., Cayre, A., Le Corre, D., Buc, E., Ychou, M., Bouche, O., Landi, B., Louvet, C, Andre, T., Bibeau, F., Diebold, MD, Rougier, P., Ducreux, M., Tomasic, G., Emile, JF, Penault-Llorca, F., and Laurent-Puig, P (2008) KRAS mutations as an independent prognostic factor in patients with advanced colorectal cancer treated with cetuximab. J Clin Oncol 26, 374-9.
[0331] [0331] 7. Diehl, F., Li, M., Dressman, D., He, Y., Shen, D., Szabo, S., Diaz, LA, Jr., Goodman, SN, David, KA, Juhl, H., Kinzler, KW, and Vogelstein, B. (2005) Detection and quantification of mutations in the plasma of patients with colorectal tumors. Proc Natl Acad Sci USA; 102, 16368-73.
[0332] [0332] 8. Struchkov, V. A., Strazhevskaya, N. B., and Zhdanov, R. I. (2002) DNA-bound lipids of normal and tumor cells: retrospective and out100ks for functional genomics. Bioelectrochemistry 58, 23-30.
[0333] [0333] 9. Wang, BG, Huang, HY, Chen, Y. C, Bristow, RE, Kassauei, K., Cheng, C. C, Roden, R., Sokoll, LJ, Chan, DW, and Shih Ie , M. (2003) Increased plasma DNA integrity in cancer patients. Cancer Res 63, 3966-8.
[0334] [0334] 10. Smith, G, Carey, FA, Beattie, J., Wilkie, MJ, Lightfoot, TJ, Coxhead, J., Garner, R. C, Steele, RJ, and Wolf, CR (2002) Mutations in APC, Kirsten-ras, and p53 ~ alternative genetic pathways to colorectal cancer. Proc Natl Acad Sci USA 99, 9433-8.
[0335] [0335] 11. Einspahr, JG, Martinez, ME, Jiang, R., Hsu, CH, Rashid, A., Bhattacharrya, AK, Ahnen, DJ, Jacobs, ET, Houlihan, PS, Webb, CR, Alberts, DS , and Hamilton, SR (2006) Associations of Ki-ras proto-oncogene mutation and 53 gene overexpression in sporadic colorectal adenomas with demographic and linicopathologic characteristics. Cancer Epidemiol Biomarkers Prev 15, 1443-50.
[0336] [0336] 12. Ferron, M., Praz, F., and Pocard, M. (2005). The genetics of colorectal cancer. Ann Chir 130, 602-7.
[0337] [0337] 13. Wang, B.G, Huang, HY, Chen, Y. C, Bristow, RE, Kassauei, K., Cheng, C. C, Roden, R., Sokoll, LJ, Chan, DW, and Shih Ie, M. (2003) Increased plasma DNA Integrity In cancer patients. Cancer Res 63, 3966-8.
[0338] [0338] 14. Deligezer, U., Eralp, Y., Akisik, EE, Akisik, EZ, Saip, P., Topuz, E., and Dalay, N. (2008) Size distribution of circulating cell-free DNA in sera of breast cancer patients in the course of adjuvant chemotherapy. Clin Chem Lab Med 46, 311-7.
[0339] [0339] 15. Umetani, N., Giuliano, AE, Hiramatsu, SH, Amersi, F., Nakagawa, T., Martino, S., and Hoon, DS (2006) Prediction of breast tumor progression by integrity of free circulating DNA in serum. J Clin Oncol 24, 42706.
[0340] [0340] 16. Chan, K. C, Zhang, J., Hui, AB, Wong, N., Lau, TK, Leung, TN, Lo, KW, Huang, DW, and Lo, YM (2004) Size distributions of maternal and fetal DNA in maternal plasma. Clin Chem 50, 88-92.
[0341] [0341] 17. Ellinger, J., Wittkamp, V., Albers, P., Perabo, FG, Mueller, S. C, von Ruecker, A., and Bastian, PJ (2009) Cell-free circulating DNA: diagnostic value in patients with testicular germ cell cancer. J Urol 181,363-71.
[0342] [0342] 18. Mamon, H., Hader, C, Li, J., Wang, L., Kulke, M., Amicarelli, G., Shehi, E., Adlerstein, D., Roper, K., Killion , L., Hooshmand, S., and Makrigiorgos, GM (2008) Preferential amplification of apoptotic DNA from plasma: potential for enhancing detection of minor DNA alterations in circulating DNA. Clin Chem 54, 1582-4.
[0343] [0343] 19. Schmidt, B., Weickmann, S., Witt, C, and Fleischhacker, M. (2008) Integrity of cell-free plasma DNA in patients with lung cancer and nonmalignant lung disease. Ann N Y Acad Sci 1137, 207-13.
[0344] [0344] 20. Liu, K. J., Brock, M. V., Shih Ie, M, and Wang, T. H. (2010) Decoding circulating nucleic acids in human serum using microfluidic single molecule spectroscopy. J Am Chem Soc 132, 5793-8.
[0345] [0345] 21. Thierry, AR, Mouliere, F., Gongora, C, Oilier, J., Robert, B., Ychou, M., Del Rio, M., and Molina, F. Origin and quantification of circulating DNA in mice with human colorectal cancer xenografts. Nucleic Acids Res. May 21, 2010. in press, available online.
[0346] [0346] 22. Frattini et al. (2006), Annals of the New York Academy of Sciences; Volume 1075, Circulating Nucleic Acids in Plasma and Serum IV; pages 185-190.

权利要求:
Claims (15)
[0001]
IN VITRO DIAGNOSTIC METHOD, prognosis, or access to the evolution of cancer in a sample of an individual, characterized by said method comprising calculating the integrity index of cell-free DNA in a sample of body fluid obtained from an individual, wherein the integrity index is calculated by a method comprising (i) determining, from a PCR amplification of a short cell-free DNA sequence in said body fluid sample, the concentration or quantity of a short amplicon, wherein said short sequence is less than 100 bp in length, (ii) determining, from a PCR amplification of a long cell-free DNA sequence in said body fluid sample, the concentration or amount of a long amplicon, wherein said long sequence has a length comprised between 180 and 450 bp, and (iii) calculating the concentration or quantity ratio of said amplicons of long and short size, and where the ratio of long / short size is indicative of the presence of a tumor.
[0002]
METHOD according to claim 1, characterized in that said short sequence in (i) has a length comprised between 50 and 100 bp.
[0003]
METHOD according to claim 1, characterized in that said short sequence in (i) has a length comprised between 60 and 100 bp, or between 43 and 100, and said long sequence in (ii) has a length greater than 200 bp.
[0004]
METHOD according to any one of claims 1 to 3, characterized in that the integrity index is calculated repeatedly over a period of time in samples of body fluid from an individual, wherein a decrease in the integrity index over the interval is indicative of the progression of cancer in the subject.
[0005]
METHOD, according to any one of claims 1 to 4, characterized in that the body fluid sample is selected from the group consisting of whole blood, serum, plasma, urine, saliva, sputum fluids, colonic effluent, bone marrow effluent , lymph, cerebrospinal fluid, tear fluid, sweat, milk, feces, bronchial washes or ascites.
[0006]
METHOD according to any one of claims 1 to 5, characterized in that the cell-free DNA is circulating DNA.
[0007]
METHOD according to any one of claims 1 to 6, characterized in that the long sequence partially or totally comprises the short sequence
[0008]
METHOD according to any one of claims 1 to 7, characterized in that the PCR is Q-PCR.
[0009]
METHOD, according to any one of claims 1 to 6, characterized by the cancer being colorectal cancer, lung cancer, breast cancer, pancreatic cancer, liver cancer, among others.
[0010]
IN VITRO DIAGNOSTIC METHOD, prognosis, or access to the evolution of cancer in a sample of a patient, characterized by this method comprising: a) calculate the proportion of the size fraction (SFR) of cell-free DNA in a sample of body fluid obtained from an individual, and b) compare the SFR obtained with that of a healthy individual, where a decreased SFR is indicative of the presence of cancer, and wherein the SFR is calculated by a method comprising (i) calculating, from a PCR amplification of said body fluid sample, the concentration or quantity of a short cell-free DNA strand in said fluid sample (ii) calculate, from a PCR amplification of said body fluid sample, the concentration or amount of a long cell free DNA strand in said body fluid sample, and (iii) calculate the ratio of the concentration or amount of said cell-free DNA of long and short size, and in which: the short cell free size DNA range is between 60 and 100 bp and the long size free cell DNA range is between 145 and 409 bp, or the short cell free DNA range is between 60 and 100 bp, or between 43 and 100 bp, or between 60 and 145 bp, and the long-range free cell DNA range is greater than 200 bp, or the short cell free DNA range is less than 100 bp, and the long free cell DNA range is between 180 and 450 bp; the short cell free DNA range is less than 100 bp, and the long free cell DNA range is between 249 and 409 bp, preferably the short free cell DNA range is within the range 73 to 100 bp, and the long cell free DNA range is within the range 300 to 357 bp.
[0011]
METHOD, according to claim 10, characterized in that the body fluid sample is selected from the group consisting of whole blood, serum, plasma, urine, saliva, sputum fluids, colonic effluent, bone marrow effluent, lymph, fluid cerebrospinal, tear fluid, sweat, milk, feces, bronchial washes or ascites.
[0012]
METHOD according to any one of claims 10 to 11, characterized in that the cell-free DNA is circulating DNA.
[0013]
METHOD according to any one of claims 10 to 12, characterized in that the long sequence comprises partially or totally the short sequence.
[0014]
METHOD according to any one of claims 10 to 13, characterized in that the PCR is Q-PCR.
[0015]
METHOD according to any one of claims 10 to 14, characterized in that the SFR is calculated repeatedly over a period of time in samples of body fluid from an individual, in which a decrease in the SFR over the interval is indicative of the progression of cancer in the subject.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20190352725A1|2019-11-21|Analytical methods for cell free nucleic acids and applications

---

Buono et al.2019|Circulating tumor DNA analysis in breast cancer: Is it ready for prime-time?

---

Chang et al.2017|Review of the clinical applications and technological advances of circulating tumor DNA in cancer monitoring

---

JP5843840B2|2016-01-13|New cancer marker

---

JP2008545418A|2008-12-18|Use of free circulating DNA for cancer diagnosis, prognosis, and treatment

---

Zhang et al.2019|The interplay of circulating tumor DNA and chromatin modification, therapeutic resistance, and metastasis

---

EP3198026A1|2017-08-02|Method of determining pik3ca mutational status in a sample

---

BRPI0709397A2|2011-07-05|primary cell propagation

---

Wang et al.2017|DNA methylation signatures in circulating cell-free DNA as biomarkers for the early detection of cancer

---

WO2012095378A1|2012-07-19|High resolution melting analysis as a prescreening tool

---

Franczak et al.2019|Technical considerations for circulating tumor DNA detection in oncology

---

Amira et al.2003|Microsatellite instability in urothelial carcinoma of the upper urinary tract

---

Kerachian et al.2019|Cell free circulating tumor nucleic acids, a revolution in personalized cancer medicine

---

US20160032406A1|2016-02-04|Diagnostic Method Using PALB2/US

---

Sanchez et al.2021|Circulating nuclear DNA structural features, origins, and complete size profile revealed by fragmentomics

---

Riaz et al.2018|Liquid biopsy approach in the management of prostate cancer

---

JP6438119B2|2018-12-12|A method for rapid and sensitive detection of hot spot mutations

---

Markovic et al.2013|Microsatellite instability affecting the T17 repeats in intron 8 of HSP110, as well as five mononucleotide repeats in patients with colorectal carcinoma

---

WO2019156054A1|2019-08-15|Marker for mlh1 methylation group determination and determination method

---

ES2637385T3|2017-10-13|Method and kit to determine genome integrity and / or the quality of a library of DNA sequences obtained by complete genome amplification by deterministic restriction sites

---

Lim et al.2017|Circulating tumor DNA—From bench to bedside

---

Brand et al.2008|Association of polymorphisms in TGFB1 and prostate cancer prognosis

---

WO2016103727A1|2016-06-30|Method for promoting amplification of specific nucleic acid sequence

---

US11279979B2|2022-03-22|Method of determining PIK3CA mutational status in a sample

---

Chattopadhyay2020|Application of Circulating Cell‐free DNA for Personalized Cancer Therapy

同族专利:

---

公开号 | 公开日

---

WO2012028746A1|2012-03-08|

---

CA2809914A1|2012-03-08|

---

US9580755B2|2017-02-28|

---

JP6608788B2|2019-11-20|

---

JP2013536679A|2013-09-26|

---

EP2611935A1|2013-07-10|

---

US20130224740A1|2013-08-29|

---

EP2426217A1|2012-03-07|

---

JP2017042165A|2017-03-02|

---

JP6010537B2|2016-10-19|

---

US20190352725A1|2019-11-21|

---

US20170166982A1|2017-06-15|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US6020124A|1992-04-27|2000-02-01|Trustees Of Dartmouth College|Detection of soluble gene sequences in biological fluids|

---

US8679788B2|2004-03-22|2014-03-25|The Johns Hopkins University|Methods for the detection of nucleic acid differences|

---

JP2008519606A|2004-11-12|2008-06-12|アンビオンインコーポレーティッド|Methods and compositions relating to miRNA and miRNA-inhibiting molecules|

---

WO2009051842A2|2007-10-18|2009-04-23|The Johns Hopkins University|Detection of cancer by measuring genomic copy number and strand length in cell-free dna|US10337054B2|2004-02-02|2019-07-02|Quantum-Si Incorporated|Enrichment of nucleic acid targets|

---

US11111543B2|2005-07-29|2021-09-07|Natera, Inc.|System and method for cleaning noisy genetic data and determining chromosome copy number|

---

US11111544B2|2005-07-29|2021-09-07|Natera, Inc.|System and method for cleaning noisy genetic data and determining chromosome copy number|

---

US9424392B2|2005-11-26|2016-08-23|Natera, Inc.|System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals|

---

US10316362B2|2010-05-18|2019-06-11|Natera, Inc.|Methods for simultaneous amplification of target loci|

---

US20190010543A1|2010-05-18|2019-01-10|Natera, Inc.|Methods for simultaneous amplification of target loci|

---

EP2473638B1|2009-09-30|2017-08-09|Natera, Inc.|Methods for non-invasive prenatal ploidy calling|

---

RU2620959C2|2010-12-22|2017-05-30|Натера, Инк.|Methods of noninvasive prenatal paternity determination|

---

WO2013060762A1|2011-10-25|2013-05-02|Roche Diagnostics Gmbh|Method for diagnosing a disease based on plasma-dna distribution|

---

US9892230B2|2012-03-08|2018-02-13|The Chinese University Of Hong Kong|Size-based analysis of fetal or tumor DNA fraction in plasma|

---

WO2013138510A1|2012-03-13|2013-09-19|Patel Abhijit Ajit|Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing|

---

US10077474B2|2012-05-29|2018-09-18|Abbott Molecular, Inc.|Method of designing primers, method of detecting single nucleotide polymorphisms , method of distinguishing SNPs, and related primers, detectable oligonucleotides, and kits|

---

US11261494B2|2012-06-21|2022-03-01|The Chinese University Of Hong Kong|Method of measuring a fractional concentration of tumor DNA|

---

PT2893040T|2012-09-04|2019-04-01|Guardant Health Inc|Systems and methods to detect rare mutations and copy number variation|

---

US20160040229A1|2013-08-16|2016-02-11|Guardant Health, Inc.|Systems and methods to detect rare mutations and copy number variation|

---

US10876152B2|2012-09-04|2020-12-29|Guardant Health, Inc.|Systems and methods to detect rare mutations and copy number variation|

---

WO2014168801A2|2013-04-08|2014-10-16|Merck Sharp & Dohme Corp.|Methods and compositions for treating cancer|

---

US10174375B2|2013-09-20|2019-01-08|The Chinese University Of Hong Kong|Sequencing analysis of circulating DNA to detect and monitor autoimmune diseases|

---

US10577655B2|2013-09-27|2020-03-03|Natera, Inc.|Cell free DNA diagnostic testing standards|

---

WO2015058176A1|2013-10-19|2015-04-23|Trovagene, Inc.|Detecting mutations in disease over time|

---

US10227655B2|2013-10-29|2019-03-12|Region Syddanmark|Method for analyzing body fluid samples|

---

EP3077072B1|2013-12-02|2019-03-06|Biocartis N.V.|Extraction of circulating nucleic acids|

---

AU2014369841B2|2013-12-28|2019-01-24|Guardant Health, Inc.|Methods and systems for detecting genetic variants|

---

US9677118B2|2014-04-21|2017-06-13|Natera, Inc.|Methods for simultaneous amplification of target loci|

---

US10179937B2|2014-04-21|2019-01-15|Natera, Inc.|Detecting mutations and ploidy in chromosomal segments|

---

CA2949883A1|2014-05-27|2015-12-03|Inserm |Methods for predicting the survival time of patients suffering from cancer|

---

WO2015200377A1|2014-06-24|2015-12-30|Abbott Molecular Inc.|Detection of single nucleotide polymorphisms in human kras|

---

ES2815349T3|2014-06-27|2021-03-29|Inst Nat Sante Rech Med|Methods using circulating DNA and miRNA as biomarkers for female infertility|

---

US10184150B2|2014-06-27|2019-01-22|INSERM |Free nucleic acids and miRNA as non-invasive method for determining embryo quality|

---

CA2957657A1|2014-08-22|2016-02-25|Resolution Bioscience, Inc.|Methods for quantitative genetic analysis of cell free dna|

---

ES2708030T3|2014-10-20|2019-04-08|Inst Nat Sante Rech Med|Methods to explore an individual in search of a cancer|

---

US10364467B2|2015-01-13|2019-07-30|The Chinese University Of Hong Kong|Using size and number aberrations in plasma DNA for detecting cancer|

---

KR20170125044A|2015-02-10|2017-11-13|더 차이니즈 유니버시티 오브 홍콩|Mutation detection for cancer screening and fetal analysis|

---

CN104762399A|2015-04-17|2015-07-08|上海产业技术研究院|Tumor circulating DNA KRAS mutation detection method|

---

EP3283657A4|2015-04-17|2018-09-12|The Translational Genomics Research Institute|Quality assessment of circulating cell-free dna using multiplexed droplet digital pcr|

---

CA2986036A1|2015-05-18|2016-11-24|Karius, Inc.|Compositions and methods for enriching populations of nucleic acids|

---

US11130986B2|2015-05-20|2021-09-28|Quantum-Si Incorporated|Method for isolating target nucleic acid using heteroduplex binding proteins|

---

CN104894268B|2015-06-05|2018-02-09|上海美吉生物医药科技有限公司|The method and its application of the DNA concentration of Apoptosis are derived from quantitative sample|

---

FR3037970B1|2015-06-23|2018-11-30|Idemia Identity And Security|PCR KIT FOR CAPILLARY ELECTROPHORESIS|

---

JP6837632B2|2015-07-17|2021-03-03|凸版印刷株式会社|A method of using the amount of cell-free DNA per unit amount of a body fluid sample as an index for evaluating the health condition|

---

AU2016334233A1|2015-10-09|2018-04-12|Accuragen Holdings Limited|Methods and compositions for enrichment of amplification products|

---

WO2017079537A1|2015-11-04|2017-05-11|Duke University|Polycationic polymers for use in treating and detecting cancer|

---

JP2019507585A|2015-12-17|2019-03-22|ガーダント ヘルス， インコーポレイテッド|Method for determining oncogene copy number by analysis of cell free DNA|

---

EP3475449A4|2016-06-23|2019-12-25|Accuragen Holdings Limited|Cell-free nucleic acid standards and uses thereof|

---

JP2019531700A|2016-07-06|2019-11-07|ガーダント ヘルス， インコーポレイテッド|Method for fragment-free profiling of cell-free nucleic acids|

---

JP6966052B2|2016-08-15|2021-11-10|アキュラーゲン ホールディングス リミテッド|Compositions and Methods for Detecting Rare Sequence Variants|

---

AU2018212272A1|2017-01-25|2019-07-18|Grail, Inc.|Diagnostic applications using nucleic acid fragments|

---

US10011870B2|2016-12-07|2018-07-03|Natera, Inc.|Compositions and methods for identifying nucleic acid molecules|

---

EP3610034A4|2017-04-12|2020-12-16|Karius, Inc.|Sample preparation methods, systems and compositions|

---

WO2019013613A2|2017-07-09|2019-01-17|Hakken Enterprise Sa De Cv|Methods and kids for determining a risk of cancer|

---

KR20200035427A|2017-07-26|2020-04-03|더 차이니즈 유니버시티 오브 홍콩|Augmentation of cancer screening using cell-free viral nucleic acids|

---

CN107447013B|2017-08-31|2020-06-05|上海伯豪生物技术有限公司|Method for detecting mutation sites of codons 12 and 13 of Kras gene and kit thereof|

---

WO2019110750A1|2017-12-07|2019-06-13|INSERM |Method for screening a subject for a cancer|

---

WO2019133752A1|2017-12-28|2019-07-04|Development Center For Biotechnology|A method for predicting drug efficacy|

---

EP3743518A4|2018-01-24|2021-09-29|Freenome Holdings, Inc.|Methods and systems for abnormality detection in the patterns of nucleic acids|

---

CN108179191A|2018-02-05|2018-06-19|广州市达瑞生物技术股份有限公司|A kind of kit for detecting mankind's ctDNA gene mutations|

---

EP3755811A4|2018-02-21|2021-11-10|Nucleix Ltd.|Methods and kits for determining the efficiency of plasma separation from whole blood|

---

US11203782B2|2018-03-29|2021-12-21|Accuragen Holdings Limited|Compositions and methods comprising asymmetric barcoding|

---

AU2019261597A1|2018-04-24|2020-11-19|Grail, Llc|Systems and methods for using pathogen nucleic acid load to determine whether a subject has a cancer condition|

---

WO2021001431A1|2019-07-02|2021-01-07|INSERM |Use of pi3ka-selective inhibitors for treating metastatic disease in patients suffering from pancreatic cancer|

---

WO2021023650A1|2019-08-02|2021-02-11|INSERM |Method for screening a subject for a cancer|

---

WO2021061640A1|2019-09-23|2021-04-01|Flagship Pioneering Innovations V, Inc.|Compositions and methods for modulating genomic complex integrity index|

---

JP2020188767A|2020-05-25|2020-11-26|レゾリューション バイオサイエンス， インコーポレイテッド|METHODS FOR QUANTITATIVE GENETIC ANALYSIS OF CELL FREE DNA |

---

WO2021245209A1|2020-06-04|2021-12-09|INSERM |Methods for diagnosing and treating autism|

---

WO2022002873A1|2020-06-30|2022-01-06|INSERM |Methods for predicting the risk of recurrence and/or death of patients suffering from a solid cancer after preoperative adjuvant therapies|

法律状态:
2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-06-04| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2019-12-17| B07G| Grant request does not fulfill article 229-c lpi (prior consent of anvisa) [chapter 7.7 patent gazette]|

---

2020-02-04| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2020-07-21| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2020-09-08| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 05/09/2011, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US38008410P| true| 2010-09-03|2010-09-03|

---

EP10305952.3|2010-09-03|

---

EP10305952A|EP2426217A1|2010-09-03|2010-09-03|Analytical methods for cell free nucleic acids and applications|

---

US61/380,084|2010-09-03|

---

PCT/EP2011/065333|WO2012028746A1|2010-09-03|2011-09-05|Analytical methods for cell free nucleic acids and applications|

---